\
| Variant ID: vg0507091150 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7091150 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.27, others allele: 0.00, population size: 70. )
CTAGAGGTGCTCAAGAAGAACATCGACACATTCGCCTGGAGCCCTGACGAGGTGGGGGGTGTTCCGGCAGATCTCATCATGCATCACCTGGCGGTCAAGC[T/C]
GGACATTAAGCCAAGAAAACAGAAGTTGCGCAAGATGTCTGCCGACCGCCAAGAAGCGGCGAAAGCCGAGGTACAAAAATTGCTCAGGGCAGGGGTAATC
GATTACCCCTGCCCTGAGCAATTTTTGTACCTCGGCTTTCGCCGCTTCTTGGCGGTCGGCAGACATCTTGCGCAACTTCTGTTTTCTTGGCTTAATGTCC[A/G]
GCTTGACCGCCAGGTGATGCATGATGAGATCTGCCGGAACACCCCCCACCTCGTCAGGGCTCCAGGCGAATGTGTCGATGTTCTTCTTGAGCACCTCTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.90% | 18.90% | 3.39% | 21.77% | NA |
| All Indica | 2759 | 78.50% | 0.70% | 4.28% | 16.56% | NA |
| All Japonica | 1512 | 10.30% | 56.70% | 1.85% | 31.08% | NA |
| Aus | 269 | 94.40% | 0.40% | 2.23% | 2.97% | NA |
| Indica I | 595 | 87.10% | 0.50% | 3.36% | 9.08% | NA |
| Indica II | 465 | 61.90% | 1.70% | 8.17% | 28.17% | NA |
| Indica III | 913 | 78.50% | 0.30% | 3.94% | 17.20% | NA |
| Indica Intermediate | 786 | 81.80% | 0.50% | 3.05% | 14.63% | NA |
| Temperate Japonica | 767 | 1.20% | 91.10% | 0.52% | 7.17% | NA |
| Tropical Japonica | 504 | 20.40% | 9.70% | 4.37% | 65.48% | NA |
| Japonica Intermediate | 241 | 18.30% | 45.60% | 0.83% | 35.27% | NA |
| VI/Aromatic | 96 | 24.00% | 0.00% | 3.12% | 72.92% | NA |
| Intermediate | 90 | 48.90% | 18.90% | 5.56% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507091150 | T -> DEL | LOC_Os05g12340.1 | N | frameshift_variant | Average:24.478; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0507091150 | T -> C | LOC_Os05g12340.1 | missense_variant ; p.Leu196Pro; MODERATE | nonsynonymous_codon ; L196S | Average:24.478; most accessible tissue: Minghui63 panicle, score: 50.413 | benign |
1.361 |
TOLERATED | 0.12 |
| vg0507091150 | T -> C | LOC_Os05g12340.1 | missense_variant ; p.Leu196Pro; MODERATE | nonsynonymous_codon ; L196P | Average:24.478; most accessible tissue: Minghui63 panicle, score: 50.413 | benign |
-0.378 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507091150 | NA | 3.26E-42 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507091150 | NA | 1.54E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507091150 | NA | 1.20E-06 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | NA | 1.69E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | NA | 3.37E-27 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | NA | 2.76E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | 7.47E-12 | 3.71E-12 | mr1593 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | 2.05E-09 | 2.66E-26 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | NA | 7.10E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | NA | 2.97E-24 | mr1862 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | NA | 2.25E-07 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | NA | 3.78E-51 | mr1093_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | NA | 1.50E-10 | mr1093_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | NA | 3.76E-09 | mr1235_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | NA | 2.99E-06 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | 8.70E-09 | 1.26E-11 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | 3.78E-14 | 1.04E-37 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091150 | NA | 2.09E-13 | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |