| Variant ID: vg0507081467 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7081467 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.25, others allele: 0.00, population size: 250. )
CAGACATCCCATCTATTTTGGTACCAGAACAAAAGAACCTGAGAGGGTTGGTCACCATGTGTTTGCTAAGAAATGCGCTGCCAGTAGATGACAAATAACT[C/T]
ACAGGATTGTGGTGAGGTCGAACTGAACAATTGGAGGAGGGGCAGCACTCAGATTGAAGGAGGGGACATGTACCTATAACAGAAAAGTTTGTTAATAGTG
CACTATTAACAAACTTTTCTGTTATAGGTACATGTCCCCTCCTTCAATCTGAGTGCTGCCCCTCCTCCAATTGTTCAGTTCGACCTCACCACAATCCTGT[G/A]
AGTTATTTGTCATCTACTGGCAGCGCATTTCTTAGCAAACACATGGTGACCAACCCTCTCAGGTTCTTTTGTTCTGGTACCAAAATAGATGGGATGTCTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.20% | 39.20% | 0.11% | 0.55% | NA |
| All Indica | 2759 | 60.80% | 38.30% | 0.11% | 0.76% | NA |
| All Japonica | 1512 | 59.90% | 39.80% | 0.13% | 0.20% | NA |
| Aus | 269 | 80.30% | 19.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.00% | 16.80% | 0.00% | 0.17% | NA |
| Indica II | 465 | 26.70% | 72.50% | 0.22% | 0.65% | NA |
| Indica III | 913 | 58.40% | 40.20% | 0.22% | 1.20% | NA |
| Indica Intermediate | 786 | 66.90% | 32.30% | 0.00% | 0.76% | NA |
| Temperate Japonica | 767 | 90.50% | 9.40% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 13.70% | 85.70% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 58.90% | 40.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 50.00% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507081467 | C -> T | LOC_Os05g12310.1 | upstream_gene_variant ; 3109.0bp to feature; MODIFIER | silent_mutation | Average:70.362; most accessible tissue: Callus, score: 82.695 | N | N | N | N |
| vg0507081467 | C -> T | LOC_Os05g12320.1 | upstream_gene_variant ; 1416.0bp to feature; MODIFIER | silent_mutation | Average:70.362; most accessible tissue: Callus, score: 82.695 | N | N | N | N |
| vg0507081467 | C -> T | LOC_Os05g12310-LOC_Os05g12320 | intergenic_region ; MODIFIER | silent_mutation | Average:70.362; most accessible tissue: Callus, score: 82.695 | N | N | N | N |
| vg0507081467 | C -> DEL | N | N | silent_mutation | Average:70.362; most accessible tissue: Callus, score: 82.695 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507081467 | NA | 7.86E-17 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507081467 | NA | 5.34E-13 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507081467 | 1.77E-06 | NA | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507081467 | 2.80E-06 | 8.67E-09 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507081467 | NA | 2.14E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507081467 | 7.81E-07 | NA | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507081467 | 3.98E-06 | 4.12E-10 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507081467 | NA | 4.14E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507081467 | 1.76E-43 | 3.36E-79 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507081467 | 6.40E-32 | 1.23E-61 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/