\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507078625:

Variant ID: vg0507078625 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7078625
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAAGGAAACGAAGTGTATTGAATTTTGAATTGTTTTCTTTCTTTTTTTCCCCTCCCCCCATTACATGGCCCTAGGAGACTATTAATAGCCCCATTACA[G/A]
GTTTTTACTATTAGGGTTTAGGTTGTACAGGGGAATTTACATGATTACCCTTACGAAAGGGACATTTACAGGGGTACATAATGTTATAGGGGCTCATGGG

Reverse complement sequence

CCCATGAGCCCCTATAACATTATGTACCCCTGTAAATGTCCCTTTCGTAAGGGTAATCATGTAAATTCCCCTGTACAACCTAAACCCTAATAGTAAAAAC[C/T]
TGTAATGGGGCTATTAATAGTCTCCTAGGGCCATGTAATGGGGGGAGGGGAAAAAAAGAAAGAAAACAATTCAAAATTCAATACACTTCGTTTCCTTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 37.90% 0.47% 0.00% NA
All Indica  2759 45.30% 54.10% 0.62% 0.00% NA
All Japonica  1512 95.90% 3.90% 0.20% 0.00% NA
Aus  269 20.10% 79.90% 0.00% 0.00% NA
Indica I  595 29.20% 70.40% 0.34% 0.00% NA
Indica II  465 75.50% 24.10% 0.43% 0.00% NA
Indica III  913 45.90% 53.10% 0.99% 0.00% NA
Indica Intermediate  786 38.90% 60.60% 0.51% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 4.20% 0.20% 0.00% NA
Japonica Intermediate  241 85.10% 14.10% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507078625 G -> A LOC_Os05g12310.1 upstream_gene_variant ; 267.0bp to feature; MODIFIER silent_mutation Average:60.012; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0507078625 G -> A LOC_Os05g12320.1 upstream_gene_variant ; 4258.0bp to feature; MODIFIER silent_mutation Average:60.012; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0507078625 G -> A LOC_Os05g12310-LOC_Os05g12320 intergenic_region ; MODIFIER silent_mutation Average:60.012; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507078625 NA 3.00E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 1.13E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 2.18E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 2.60E-07 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 4.99E-08 9.89E-12 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 2.03E-13 1.78E-17 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 2.65E-13 9.35E-32 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 2.90E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 4.19E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 3.00E-07 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 9.44E-07 9.44E-07 mr1173_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 2.39E-08 3.67E-26 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 1.14E-08 6.57E-17 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 3.06E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 5.12E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 1.22E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 2.85E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 6.30E-17 1.49E-25 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 5.28E-16 3.90E-42 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 1.77E-08 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 9.53E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 8.99E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 1.59E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 9.76E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507078625 NA 6.07E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251