\
| Variant ID: vg0507078625 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7078625 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 109. )
TGGAAGGAAACGAAGTGTATTGAATTTTGAATTGTTTTCTTTCTTTTTTTCCCCTCCCCCCATTACATGGCCCTAGGAGACTATTAATAGCCCCATTACA[G/A]
GTTTTTACTATTAGGGTTTAGGTTGTACAGGGGAATTTACATGATTACCCTTACGAAAGGGACATTTACAGGGGTACATAATGTTATAGGGGCTCATGGG
CCCATGAGCCCCTATAACATTATGTACCCCTGTAAATGTCCCTTTCGTAAGGGTAATCATGTAAATTCCCCTGTACAACCTAAACCCTAATAGTAAAAAC[C/T]
TGTAATGGGGCTATTAATAGTCTCCTAGGGCCATGTAATGGGGGGAGGGGAAAAAAAGAAAGAAAACAATTCAAAATTCAATACACTTCGTTTCCTTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.60% | 37.90% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 45.30% | 54.10% | 0.62% | 0.00% | NA |
| All Japonica | 1512 | 95.90% | 3.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 20.10% | 79.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 29.20% | 70.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 75.50% | 24.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 45.90% | 53.10% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 38.90% | 60.60% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 14.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 26.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507078625 | G -> A | LOC_Os05g12310.1 | upstream_gene_variant ; 267.0bp to feature; MODIFIER | silent_mutation | Average:60.012; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0507078625 | G -> A | LOC_Os05g12320.1 | upstream_gene_variant ; 4258.0bp to feature; MODIFIER | silent_mutation | Average:60.012; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0507078625 | G -> A | LOC_Os05g12310-LOC_Os05g12320 | intergenic_region ; MODIFIER | silent_mutation | Average:60.012; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507078625 | NA | 3.00E-09 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 1.13E-06 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 2.18E-11 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | 2.60E-07 | NA | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | 4.99E-08 | 9.89E-12 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | 2.03E-13 | 1.78E-17 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | 2.65E-13 | 9.35E-32 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 2.90E-06 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 4.19E-06 | mr1887 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 3.00E-07 | mr1173_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | 9.44E-07 | 9.44E-07 | mr1173_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | 2.39E-08 | 3.67E-26 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | 1.14E-08 | 6.57E-17 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 3.06E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 5.12E-09 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 1.22E-09 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 2.85E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | 6.30E-17 | 1.49E-25 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | 5.28E-16 | 3.90E-42 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 1.77E-08 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 9.53E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 8.99E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 1.59E-07 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 9.76E-06 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507078625 | NA | 6.07E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |