\
| Variant ID: vg0507073995 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7073995 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.02, others allele: 0.00, population size: 119. )
AAGAATTTGAAAAATGATTATATAGATGTAACAACTTGGTTAGTACGTGCATTTTGGTTAAAATATCTCTCTTCCACACCATACTTTTTCAGCTATATAA[A/C]
GAAAAAGCAGCCAGTTAGGTCATCTTGAGTTCCGAATAAGGTTTTAGATGTATTGCATTTGCTTGGTTATAAATACTAAAATAACCTATTATTTAAAATT
AATTTTAAATAATAGGTTATTTTAGTATTTATAACCAAGCAAATGCAATACATCTAAAACCTTATTCGGAACTCAAGATGACCTAACTGGCTGCTTTTTC[T/G]
TTATATAGCTGAAAAAGTATGGTGTGGAAGAGAGATATTTTAACCAAAATGCACGTACTAACCAAGTTGTTACATCTATATAATCATTTTTCAAATTCTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.10% | 39.60% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 60.70% | 38.90% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 59.80% | 40.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 80.30% | 19.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 26.90% | 72.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 58.60% | 40.90% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 66.00% | 33.20% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.90% | 40.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 51.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507073995 | A -> C | LOC_Os05g12310.1 | downstream_gene_variant ; 2489.0bp to feature; MODIFIER | silent_mutation | Average:24.345; most accessible tissue: Zhenshan97 flower, score: 39.624 | N | N | N | N |
| vg0507073995 | A -> C | LOC_Os05g12300-LOC_Os05g12310 | intergenic_region ; MODIFIER | silent_mutation | Average:24.345; most accessible tissue: Zhenshan97 flower, score: 39.624 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507073995 | NA | 2.13E-16 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507073995 | NA | 5.89E-12 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507073995 | 3.35E-06 | NA | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 6.16E-06 | 1.23E-08 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | NA | 2.24E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 2.53E-07 | NA | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 1.60E-06 | 2.70E-10 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | NA | 4.05E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 1.77E-46 | 5.83E-81 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 2.16E-35 | 2.57E-64 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 1.07E-16 | 4.96E-39 | mr1593 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | NA | 7.10E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | NA | 3.49E-06 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 3.43E-09 | NA | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 7.32E-10 | 2.53E-21 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | NA | 1.74E-06 | mr1268_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | NA | 9.55E-07 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | NA | 3.23E-07 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 2.11E-06 | NA | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 1.20E-06 | 9.56E-11 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 1.38E-56 | 1.73E-106 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 1.15E-42 | 6.55E-78 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 2.10E-24 | 1.01E-60 | mr1593_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 1.96E-08 | 1.83E-22 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507073995 | 3.18E-08 | 6.14E-13 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |