\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507073995:

Variant ID: vg0507073995 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7073995
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAATTTGAAAAATGATTATATAGATGTAACAACTTGGTTAGTACGTGCATTTTGGTTAAAATATCTCTCTTCCACACCATACTTTTTCAGCTATATAA[A/C]
GAAAAAGCAGCCAGTTAGGTCATCTTGAGTTCCGAATAAGGTTTTAGATGTATTGCATTTGCTTGGTTATAAATACTAAAATAACCTATTATTTAAAATT

Reverse complement sequence

AATTTTAAATAATAGGTTATTTTAGTATTTATAACCAAGCAAATGCAATACATCTAAAACCTTATTCGGAACTCAAGATGACCTAACTGGCTGCTTTTTC[T/G]
TTATATAGCTGAAAAAGTATGGTGTGGAAGAGAGATATTTTAACCAAAATGCACGTACTAACCAAGTTGTTACATCTATATAATCATTTTTCAAATTCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 39.60% 0.30% 0.00% NA
All Indica  2759 60.70% 38.90% 0.43% 0.00% NA
All Japonica  1512 59.80% 40.10% 0.07% 0.00% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 83.20% 16.80% 0.00% 0.00% NA
Indica II  465 26.90% 72.90% 0.22% 0.00% NA
Indica III  913 58.60% 40.90% 0.55% 0.00% NA
Indica Intermediate  786 66.00% 33.20% 0.76% 0.00% NA
Temperate Japonica  767 90.60% 9.40% 0.00% 0.00% NA
Tropical Japonica  504 13.30% 86.70% 0.00% 0.00% NA
Japonica Intermediate  241 58.90% 40.70% 0.41% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507073995 A -> C LOC_Os05g12310.1 downstream_gene_variant ; 2489.0bp to feature; MODIFIER silent_mutation Average:24.345; most accessible tissue: Zhenshan97 flower, score: 39.624 N N N N
vg0507073995 A -> C LOC_Os05g12300-LOC_Os05g12310 intergenic_region ; MODIFIER silent_mutation Average:24.345; most accessible tissue: Zhenshan97 flower, score: 39.624 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507073995 NA 2.13E-16 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507073995 NA 5.89E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507073995 3.35E-06 NA mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 6.16E-06 1.23E-08 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 NA 2.24E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 2.53E-07 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 1.60E-06 2.70E-10 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 NA 4.05E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 1.77E-46 5.83E-81 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 2.16E-35 2.57E-64 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 1.07E-16 4.96E-39 mr1593 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 NA 7.10E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 NA 3.49E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 3.43E-09 NA mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 7.32E-10 2.53E-21 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 NA 1.74E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 NA 9.55E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 NA 3.23E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 2.11E-06 NA mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 1.20E-06 9.56E-11 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 1.38E-56 1.73E-106 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 1.15E-42 6.55E-78 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 2.10E-24 1.01E-60 mr1593_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 1.96E-08 1.83E-22 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507073995 3.18E-08 6.14E-13 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251