\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507070828:

Variant ID: vg0507070828 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7070828
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GACGAATCTTTTGAGCCTAATTAAGCCGTCATTAGCACATATGGGTTACTGTAGTACTTTTATGGCTAATTAATTAGACTCAAAAGATTCGTTTTACGAT[T/C]
TACATGCAAACTGTGCAATTAATTTTTCTTTTTATCTATAGAGTAAATTGCACCCACGGTGCATCAACTTGGCAGGTGGGTGTAATTTGGTGCAAGAACT

Reverse complement sequence

AGTTCTTGCACCAAATTACACCCACCTGCCAAGTTGATGCACCGTGGGTGCAATTTACTCTATAGATAAAAAGAAAAATTAATTGCACAGTTTGCATGTA[A/G]
ATCGTAAAACGAATCTTTTGAGTCTAATTAATTAGCCATAAAAGTACTACAGTAACCCATATGTGCTAATGACGGCTTAATTAGGCTCAAAAGATTCGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 39.70% 0.28% 0.00% NA
All Indica  2759 60.60% 39.00% 0.43% 0.00% NA
All Japonica  1512 59.90% 40.10% 0.00% 0.00% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 83.20% 16.80% 0.00% 0.00% NA
Indica II  465 26.70% 73.10% 0.22% 0.00% NA
Indica III  913 58.30% 41.00% 0.77% 0.00% NA
Indica Intermediate  786 66.20% 33.30% 0.51% 0.00% NA
Temperate Japonica  767 90.60% 9.40% 0.00% 0.00% NA
Tropical Japonica  504 13.30% 86.70% 0.00% 0.00% NA
Japonica Intermediate  241 59.30% 40.70% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507070828 T -> C LOC_Os05g12300.1 downstream_gene_variant ; 4676.0bp to feature; MODIFIER silent_mutation Average:53.971; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N
vg0507070828 T -> C LOC_Os05g12300.2 downstream_gene_variant ; 4676.0bp to feature; MODIFIER silent_mutation Average:53.971; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N
vg0507070828 T -> C LOC_Os05g12300.3 downstream_gene_variant ; 4676.0bp to feature; MODIFIER silent_mutation Average:53.971; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N
vg0507070828 T -> C LOC_Os05g12300-LOC_Os05g12310 intergenic_region ; MODIFIER silent_mutation Average:53.971; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507070828 NA 7.86E-17 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507070828 NA 5.34E-13 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507070828 3.81E-06 NA mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 6.16E-06 1.23E-08 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 NA 2.14E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 3.50E-07 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 1.60E-06 2.70E-10 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 NA 4.14E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 2.49E-46 6.64E-81 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 2.16E-35 2.57E-64 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 1.49E-16 4.67E-39 mr1593 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 NA 4.92E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 NA 4.93E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 1.38E-09 NA mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 7.32E-10 2.53E-21 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 NA 1.46E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 NA 9.55E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 NA 3.23E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 2.43E-06 NA mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 1.20E-06 9.56E-11 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 1.45E-56 1.54E-106 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 1.15E-42 6.55E-78 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 4.21E-24 9.08E-61 mr1593_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 1.79E-08 1.46E-22 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507070828 3.18E-08 6.14E-13 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251