\
| Variant ID: vg0507051194 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7051194 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATATTTAACAATGAATCAAATGAGATGAAAAGAATAAATAATTACTTAAATTTTTGAATAAGACGAATGGTCAAACACGACTAAAAAGTCAACGGTGTCA[A/T]
ACATTTTGAAACGGAGGGAGTATTACACAGGCAACACCACACTTATACAGCTTGCGAATGCATCCCCTCTCACATGTTTAAAAAGACGGAAACCAACGGT
ACCGTTGGTTTCCGTCTTTTTAAACATGTGAGAGGGGATGCATTCGCAAGCTGTATAAGTGTGGTGTTGCCTGTGTAATACTCCCTCCGTTTCAAAATGT[T/A]
TGACACCGTTGACTTTTTAGTCGTGTTTGACCATTCGTCTTATTCAAAAATTTAAGTAATTATTTATTCTTTTCATCTCATTTGATTCATTGTTAAATAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.90% | 0.70% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 96.80% | 1.90% | 1.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.70% | 3.80% | 2.48% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507051194 | A -> T | LOC_Os05g12280.1 | upstream_gene_variant ; 328.0bp to feature; MODIFIER | silent_mutation | Average:53.458; most accessible tissue: Minghui63 root, score: 68.826 | N | N | N | N |
| vg0507051194 | A -> T | LOC_Os05g12290.1 | upstream_gene_variant ; 4670.0bp to feature; MODIFIER | silent_mutation | Average:53.458; most accessible tissue: Minghui63 root, score: 68.826 | N | N | N | N |
| vg0507051194 | A -> T | LOC_Os05g12280-LOC_Os05g12290 | intergenic_region ; MODIFIER | silent_mutation | Average:53.458; most accessible tissue: Minghui63 root, score: 68.826 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507051194 | NA | 8.58E-07 | mr1245 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507051194 | 2.60E-06 | 2.60E-06 | mr1373 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507051194 | NA | 6.58E-07 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507051194 | NA | 3.23E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507051194 | NA | 1.78E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |