\
| Variant ID: vg0507041473 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7041473 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 281. )
ACAAAACCACACTATCAATAAATGGATTCACATGTGAGATGACGTAGTTGTTACACCTAGGATGAGAATATGGCATCCTATTAATTTCGTGTGATGGCTG[G/T]
TAATAAGATGCCACGTCCTCGTCATAAGTGGAACAGCCACGCCATATCACGGGTGAATCAATTCATTGATAGTGTGATTTTCTGAAACTACACTACTAAA
TTTAGTAGTGTAGTTTCAGAAAATCACACTATCAATGAATTGATTCACCCGTGATATGGCGTGGCTGTTCCACTTATGACGAGGACGTGGCATCTTATTA[C/A]
CAGCCATCACACGAAATTAATAGGATGCCATATTCTCATCCTAGGTGTAACAACTACGTCATCTCACATGTGAATCCATTTATTGATAGTGTGGTTTTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.70% | 29.80% | 0.15% | 0.42% | NA |
| All Indica | 2759 | 51.20% | 48.10% | 0.22% | 0.54% | NA |
| All Japonica | 1512 | 99.50% | 0.30% | 0.07% | 0.13% | NA |
| Aus | 269 | 77.30% | 22.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 28.20% | 71.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 75.10% | 24.30% | 0.22% | 0.43% | NA |
| Indica III | 913 | 56.20% | 42.80% | 0.11% | 0.88% | NA |
| Indica Intermediate | 786 | 48.60% | 50.30% | 0.51% | 0.64% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 16.70% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507041473 | G -> T | LOC_Os05g12260.1 | downstream_gene_variant ; 4719.0bp to feature; MODIFIER | silent_mutation | Average:45.69; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0507041473 | G -> T | LOC_Os05g12270.1 | downstream_gene_variant ; 1114.0bp to feature; MODIFIER | silent_mutation | Average:45.69; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0507041473 | G -> T | LOC_Os05g12270-LOC_Os05g12280 | intergenic_region ; MODIFIER | silent_mutation | Average:45.69; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0507041473 | G -> DEL | N | N | silent_mutation | Average:45.69; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507041473 | NA | 5.24E-12 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507041473 | 2.63E-10 | 1.11E-23 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507041473 | 1.82E-10 | 1.75E-15 | mr1531 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507041473 | 8.48E-21 | 1.17E-27 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507041473 | 1.27E-16 | 2.22E-32 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507041473 | NA | 2.70E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507041473 | NA | 5.72E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507041473 | 4.17E-10 | 8.33E-27 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507041473 | 1.85E-08 | 2.54E-14 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507041473 | NA | 3.27E-09 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507041473 | 1.24E-23 | 5.50E-35 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507041473 | 1.48E-18 | 5.54E-44 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507041473 | NA | 8.46E-06 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |