\
| Variant ID: vg0507027003 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7027003 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.07, others allele: 0.00, population size: 107. )
ACTCACTCCGTTTCACAATGTAAGTCGTTCTAGCATTTTCCACATTCATATATCAATATGAATGTGGGAAATGCTAGAATGACTTATATTGTGAAACGGA[G/T]
GAAGTAACTAAGATCTATGTCTACTCTCCATGACTTGCCTCCACCTCAACAGATATTTCTTAATAGTGTAACAGCATTGTGATAAACAAAGATGGTTCAC
GTGAACCATCTTTGTTTATCACAATGCTGTTACACTATTAAGAAATATCTGTTGAGGTGGAGGCAAGTCATGGAGAGTAGACATAGATCTTAGTTACTTC[C/A]
TCCGTTTCACAATATAAGTCATTCTAGCATTTCCCACATTCATATTGATATATGAATGTGGAAAATGCTAGAACGACTTACATTGTGAAACGGAGTGAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.50% | 45.20% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 58.90% | 40.80% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 47.40% | 52.30% | 0.26% | 0.00% | NA |
| Aus | 269 | 29.00% | 71.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 22.70% | 77.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.70% | 13.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 68.10% | 31.40% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 59.00% | 40.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 15.90% | 83.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 89.30% | 10.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 60.20% | 39.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 26.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507027003 | G -> T | LOC_Os05g12250-LOC_Os05g12260 | intergenic_region ; MODIFIER | silent_mutation | Average:42.932; most accessible tissue: Callus, score: 61.936 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507027003 | 7.43E-08 | NA | Grain_thickness | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507027003 | NA | 3.85E-16 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507027003 | 3.54E-06 | NA | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507027003 | NA | 6.24E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | 2.07E-13 | 2.33E-37 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | 1.23E-11 | 2.79E-26 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | NA | 4.02E-21 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | NA | 1.10E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | NA | 7.49E-07 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | NA | 1.99E-12 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | NA | 7.43E-06 | mr1268_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | NA | 1.76E-09 | mr1327_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | NA | 6.53E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | NA | 1.75E-08 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | 1.20E-14 | 1.46E-42 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | 3.57E-13 | 2.70E-28 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | 1.35E-07 | 6.99E-29 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | NA | 5.58E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | NA | 1.86E-06 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507027003 | NA | 8.53E-14 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |