\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507018740:

Variant ID: vg0507018740 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7018740
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTAATTGATCTGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGACTAAACTCGGCAGGACCCACCACATACCATGACTTATACGGAAACAAAC[A/C]
TCATATATAAAAGGAGTTTCGGATAAGGAAGGATAAGAAGAGTTCTATATGAAAACGACAATGACTACTCGGATTGTACTTATATTTATCTCCTTAGTCT

Reverse complement sequence

AGACTAAGGAGATAAATATAAGTACAATCCGAGTAGTCATTGTCGTTTTCATATAGAACTCTTCTTATCCTTCCTTATCCGAAACTCCTTTTATATATGA[T/G]
GTTTGTTTCCGTATAAGTCATGGTATGTGGTGGGTCCTGCCGAGTTTAGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGACAGATCAATTAATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 4.00% 3.60% 20.17% NA
All Indica  2759 61.70% 1.70% 4.82% 31.79% NA
All Japonica  1512 96.40% 2.20% 0.00% 1.39% NA
Aus  269 30.50% 36.10% 13.75% 19.70% NA
Indica I  595 26.40% 0.20% 5.71% 67.73% NA
Indica II  465 89.50% 0.00% 0.22% 10.32% NA
Indica III  913 70.20% 1.50% 4.27% 23.99% NA
Indica Intermediate  786 62.00% 4.20% 7.51% 26.34% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 1.20% 0.00% 2.58% NA
Japonica Intermediate  241 86.30% 10.40% 0.00% 3.32% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507018740 A -> DEL N N silent_mutation Average:54.474; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0507018740 A -> C LOC_Os05g12250-LOC_Os05g12260 intergenic_region ; MODIFIER silent_mutation Average:54.474; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507018740 NA 5.40E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 2.65E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 4.36E-13 1.47E-17 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 4.66E-16 2.31E-30 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 1.09E-14 mr1904 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 1.70E-07 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 3.92E-17 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 1.92E-20 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 1.61E-12 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 1.17E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 4.97E-23 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 1.42E-15 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 5.07E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 1.21E-11 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 2.95E-14 2.19E-19 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 7.53E-20 3.21E-34 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 7.55E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507018740 NA 1.33E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251