\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507010835:

Variant ID: vg0507010835 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7010835
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CGTATACGGCTCTTTATAATACCCACACACAAAAATTAATTTTTCAAATGAACCACTTATAACGTCCACATGTAAAAATAAGGATATTTTCGCACATAGG[G/A]
CTCTTAACTCACCCACATGCAAAAATACCCCTCCTCTTCCCACTATTTTTTTTATTCTCTCCTCCCCCCCTCTCTCTCTCTCTCGCCCGGCCTCACCCGC

Reverse complement sequence

GCGGGTGAGGCCGGGCGAGAGAGAGAGAGAGGGGGGGAGGAGAGAATAAAAAAAATAGTGGGAAGAGGAGGGGTATTTTTGCATGTGGGTGAGTTAAGAG[C/T]
CCTATGTGCGAAAATATCCTTATTTTTACATGTGGACGTTATAAGTGGTTCATTTGAAAAATTAATTTTTGTGTGTGGGTATTATAAAGAGCCGTATACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 46.70% 0.21% 0.19% NA
All Indica  2759 85.30% 14.30% 0.22% 0.22% NA
All Japonica  1512 3.50% 96.20% 0.20% 0.13% NA
Aus  269 22.70% 77.30% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 79.40% 20.40% 0.00% 0.22% NA
Indica III  913 83.70% 15.60% 0.33% 0.44% NA
Indica Intermediate  786 82.40% 17.00% 0.38% 0.13% NA
Temperate Japonica  767 1.60% 98.20% 0.26% 0.00% NA
Tropical Japonica  504 3.20% 96.60% 0.20% 0.00% NA
Japonica Intermediate  241 10.40% 88.80% 0.00% 0.83% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 35.60% 62.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507010835 G -> DEL N N silent_mutation Average:71.308; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0507010835 G -> A LOC_Os05g12250.1 downstream_gene_variant ; 1849.0bp to feature; MODIFIER silent_mutation Average:71.308; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0507010835 G -> A LOC_Os05g12240-LOC_Os05g12250 intergenic_region ; MODIFIER silent_mutation Average:71.308; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0507010835 G A -0.03 -0.02 -0.02 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507010835 2.12E-08 1.75E-34 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 7.67E-07 3.30E-09 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 NA 1.88E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 NA 4.92E-15 mr1329 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 NA 7.63E-06 mr1514 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 NA 1.13E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 NA 4.10E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 3.41E-08 1.08E-33 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 1.70E-06 5.34E-12 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 3.83E-07 NA mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 NA 3.83E-09 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 2.91E-09 3.69E-38 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 7.63E-07 1.58E-09 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 8.76E-11 2.39E-23 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 9.25E-07 1.25E-07 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 NA 1.95E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 5.00E-13 2.09E-44 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 4.79E-10 5.81E-15 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 3.28E-06 1.36E-33 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507010835 7.82E-06 1.08E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251