Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0507006907:

Variant ID: vg0507006907 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7006907
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGTGATGATTTTTAACGTAATATATGATCATTTATCTTACTAAAAATTTTAATGGAAATGTGCAAAAGTATATCATGGTCCAAATTTAATATTAAAAA[A/T]
ATTCACAACCAAATATAAATGTTAGTTTTATTTAGGAAGACGAATGTAATATCGATATGTTGGCTTATCTATTACTCCCTCCGTCCCATAATATAAGGGA

Reverse complement sequence

TCCCTTATATTATGGGACGGAGGGAGTAATAGATAAGCCAACATATCGATATTACATTCGTCTTCCTAAATAAAACTAACATTTATATTTGGTTGTGAAT[T/A]
TTTTTAATATTAAATTTGGACCATGATATACTTTTGCACATTTCCATTAAAATTTTTAGTAAGATAAATGATCATATATTACGTTAAAAATCATCACCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.70% 0.11% 0.00% NA
All Indica  2759 85.90% 14.00% 0.14% 0.00% NA
All Japonica  1512 3.40% 96.60% 0.00% 0.00% NA
Aus  269 22.70% 77.30% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 79.10% 20.40% 0.43% 0.00% NA
Indica III  913 84.90% 15.10% 0.00% 0.00% NA
Indica Intermediate  786 83.20% 16.50% 0.25% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 3.20% 96.80% 0.00% 0.00% NA
Japonica Intermediate  241 10.00% 90.00% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 34.40% 64.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507006907 A -> T LOC_Os05g12230.1 upstream_gene_variant ; 4780.0bp to feature; MODIFIER silent_mutation Average:22.296; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0507006907 A -> T LOC_Os05g12240.1 upstream_gene_variant ; 1453.0bp to feature; MODIFIER silent_mutation Average:22.296; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0507006907 A -> T LOC_Os05g12240-LOC_Os05g12250 intergenic_region ; MODIFIER silent_mutation Average:22.296; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507006907 6.58E-08 3.64E-34 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 6.47E-06 9.40E-09 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 NA 7.02E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 NA 5.49E-15 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 NA 1.93E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 NA 2.25E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 7.32E-07 2.03E-32 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 NA 3.65E-10 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 1.89E-06 NA mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 NA 2.69E-07 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 1.56E-07 6.21E-37 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 NA 2.88E-08 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 2.82E-11 3.24E-24 mr1514_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 2.71E-07 1.81E-08 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 NA 4.14E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 7.03E-12 4.55E-43 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 4.41E-08 6.66E-13 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 NA 5.09E-32 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006907 NA 4.89E-06 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251