\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507006230:

Variant ID: vg0507006230 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7006230
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AATACTTTATTCACGGTCCTTTTTTCTCAACAAATCTATACCTCCAGACTCTAATTTGTTTTGTTGTGATGAATTTTATCGGCAAGAATCATTGAGTGAA[T/A]
AGCTAGCCTTAAAACCATGGGTCCAGTATTTGCTTTGCTTTACCGAAACAAAAAAAAAACATTACTTATTTGAAAATTGATTTTTTTAGTCCTGATAAGT

Reverse complement sequence

ACTTATCAGGACTAAAAAAATCAATTTTCAAATAAGTAATGTTTTTTTTTTGTTTCGGTAAAGCAAAGCAAATACTGGACCCATGGTTTTAAGGCTAGCT[A/T]
TTCACTCAATGATTCTTGCCGATAAAATTCATCACAACAAAACAAATTAGAGTCTGGAGGTATAGATTTGTTGAGAAAAAAGGACCGTGAATAAAGTATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 40.80% 0.25% 0.06% NA
All Indica  2759 34.30% 65.20% 0.40% 0.07% NA
All Japonica  1512 97.00% 3.00% 0.00% 0.00% NA
Aus  269 77.30% 22.70% 0.00% 0.00% NA
Indica I  595 16.60% 83.20% 0.17% 0.00% NA
Indica II  465 51.20% 48.40% 0.22% 0.22% NA
Indica III  913 37.50% 62.30% 0.22% 0.00% NA
Indica Intermediate  786 34.10% 64.90% 0.89% 0.13% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507006230 T -> DEL N N silent_mutation Average:36.337; most accessible tissue: Callus, score: 60.607 N N N N
vg0507006230 T -> A LOC_Os05g12230.1 upstream_gene_variant ; 4103.0bp to feature; MODIFIER silent_mutation Average:36.337; most accessible tissue: Callus, score: 60.607 N N N N
vg0507006230 T -> A LOC_Os05g12240.1 upstream_gene_variant ; 776.0bp to feature; MODIFIER silent_mutation Average:36.337; most accessible tissue: Callus, score: 60.607 N N N N
vg0507006230 T -> A LOC_Os05g12240-LOC_Os05g12250 intergenic_region ; MODIFIER silent_mutation Average:36.337; most accessible tissue: Callus, score: 60.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507006230 NA 7.05E-08 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 1.15E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 9.61E-07 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 2.42E-11 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 6.11E-14 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 6.35E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 1.44E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 2.30E-11 mr1860 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 8.62E-06 mr1860 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 2.38E-08 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 9.83E-06 mr1499_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 3.18E-13 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 4.27E-16 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 1.25E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 6.81E-06 mr1645_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 9.49E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 5.18E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507006230 NA 1.54E-08 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251