\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506979574:

Variant ID: vg0506979574 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6979574
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGGTATGTAATTCGTACTAATTATTTTTCTGTATTTGGATTTTACAAGAAAATATCCCAGCCTGCTCAAAAGTGTCCCGATTTGCACGATAGTTTTTA[A/G]
ATTAGAATATGCCATTAAATAATATCTAATTCTAGAATACATATACCGACCCCAATTTCTCTGGAGATTACATATCACTATGTATAACGCGAGATCGGTC

Reverse complement sequence

GACCGATCTCGCGTTATACATAGTGATATGTAATCTCCAGAGAAATTGGGGTCGGTATATGTATTCTAGAATTAGATATTATTTAATGGCATATTCTAAT[T/C]
TAAAAACTATCGTGCAAATCGGGACACTTTTGAGCAGGCTGGGATATTTTCTTGTAAAATCCAAATACAGAAAAATAATTAGTACGAATTACATACCAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.60% 41.70% 0.17% 3.47% NA
All Indica  2759 88.00% 11.10% 0.18% 0.76% NA
All Japonica  1512 3.50% 95.20% 0.00% 1.26% NA
Aus  269 23.40% 30.10% 0.74% 45.72% NA
Indica I  595 95.80% 4.00% 0.17% 0.00% NA
Indica II  465 80.40% 19.10% 0.22% 0.22% NA
Indica III  913 89.30% 10.30% 0.11% 0.33% NA
Indica Intermediate  786 85.00% 12.60% 0.25% 2.16% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 3.20% 94.40% 0.00% 2.38% NA
Japonica Intermediate  241 10.00% 87.10% 0.00% 2.90% NA
VI/Aromatic  96 0.00% 99.00% 0.00% 1.04% NA
Intermediate  90 43.30% 55.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506979574 A -> DEL N N silent_mutation Average:42.1; most accessible tissue: Callus, score: 79.207 N N N N
vg0506979574 A -> G LOC_Os05g12180.1 upstream_gene_variant ; 1525.0bp to feature; MODIFIER silent_mutation Average:42.1; most accessible tissue: Callus, score: 79.207 N N N N
vg0506979574 A -> G LOC_Os05g12190.1 downstream_gene_variant ; 2540.0bp to feature; MODIFIER silent_mutation Average:42.1; most accessible tissue: Callus, score: 79.207 N N N N
vg0506979574 A -> G LOC_Os05g12180-LOC_Os05g12190 intergenic_region ; MODIFIER silent_mutation Average:42.1; most accessible tissue: Callus, score: 79.207 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506979574 1.56E-09 3.80E-36 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 8.36E-09 3.89E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 NA 5.34E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 NA 6.78E-15 mr1329 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 NA 1.63E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 NA 3.62E-10 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 2.71E-10 1.09E-36 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 5.74E-08 3.01E-13 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 2.29E-08 NA mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 1.82E-06 8.65E-11 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 1.68E-10 2.82E-40 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 3.57E-09 1.37E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 NA 1.27E-06 mr1109_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 7.83E-11 2.18E-23 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 7.89E-07 8.03E-08 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 NA 4.64E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 NA 1.62E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 1.62E-13 6.34E-46 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 9.89E-12 5.41E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 9.86E-07 2.04E-35 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 4.33E-07 7.63E-09 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506979574 4.14E-07 4.14E-07 mr1877_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251