\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506971537:

Variant ID: vg0506971537 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6971537
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCTTGCGTGCTCTTTCGTCAACCATTCGCTTGCCATGGTGGGCCTTGTTGAGTATGTCTGCCATTGGTCCATTGCACTGCCCGTATCGATGATTGCCA[G/A]
AGCCACACGATGATGATCGAACGGCGTATGAACCAAGCAACCACATGACTCGAAACCCAGCCAAAATCCAGTGCCGGATGACGTGTCGGCACCCAGCGAG

Reverse complement sequence

CTCGCTGGGTGCCGACACGTCATCCGGCACTGGATTTTGGCTGGGTTTCGAGTCATGTGGTTGCTTGGTTCATACGCCGTTCGATCATCATCGTGTGGCT[C/T]
TGGCAATCATCGATACGGGCAGTGCAATGGACCAATGGCAGACATACTCAACAAGGCCCACCATGGCAAGCGAATGGTTGACGAAAGAGCACGCAAGCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.00% 47.90% 0.04% 0.08% NA
All Indica  2759 85.00% 14.90% 0.04% 0.14% NA
All Japonica  1512 1.30% 98.70% 0.00% 0.00% NA
Aus  269 23.00% 77.00% 0.00% 0.00% NA
Indica I  595 94.50% 5.40% 0.00% 0.17% NA
Indica II  465 80.40% 19.10% 0.22% 0.22% NA
Indica III  913 86.90% 13.00% 0.00% 0.11% NA
Indica Intermediate  786 78.20% 21.60% 0.00% 0.13% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 1.80% 98.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 36.70% 62.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506971537 G -> DEL N N silent_mutation Average:54.959; most accessible tissue: Minghui63 young leaf, score: 75.479 N N N N
vg0506971537 G -> A LOC_Os05g12180.1 downstream_gene_variant ; 4306.0bp to feature; MODIFIER silent_mutation Average:54.959; most accessible tissue: Minghui63 young leaf, score: 75.479 N N N N
vg0506971537 G -> A LOC_Os05g12170-LOC_Os05g12180 intergenic_region ; MODIFIER silent_mutation Average:54.959; most accessible tissue: Minghui63 young leaf, score: 75.479 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506971537 2.97E-11 1.77E-33 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 8.41E-09 3.36E-08 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 NA 3.74E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 NA 5.50E-14 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 NA 6.74E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 4.11E-06 NA mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 9.65E-07 6.87E-09 mr1593 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 4.34E-11 4.62E-33 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 2.05E-08 1.91E-10 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 8.80E-07 NA mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 NA 2.06E-07 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 6.01E-13 1.17E-38 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 9.65E-10 1.68E-09 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 1.98E-09 9.40E-22 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 3.23E-06 1.73E-06 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 5.54E-06 NA mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 NA 8.67E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 8.72E-17 7.51E-46 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 1.13E-12 5.59E-15 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 1.09E-06 2.42E-35 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506971537 3.81E-06 2.00E-09 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251