Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0506950500:

Variant ID: vg0506950500 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6950500
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

CTGATTTACATCGTAAAAACGTGTCACGGCTGAAAGACACCTTAAAAATGGTAATTTGTTAGAGGACACTCTCGGCTTAATTAAAGAGATAAATTCTTAA[G/A]
AAACACGAGAATATCCCTAGGATTATATGCTTCAAACATAGCGCTAAAGTAAAAAATTAAGAAATTATGTAAATCTAAATTTACCATCATCCCAAGTATA

Reverse complement sequence

TATACTTGGGATGATGGTAAATTTAGATTTACATAATTTCTTAATTTTTTACTTTAGCGCTATGTTTGAAGCATATAATCCTAGGGATATTCTCGTGTTT[C/T]
TTAAGAATTTATCTCTTTAATTAAGCCGAGAGTGTCCTCTAACAAATTACCATTTTTAAGGTGTCTTTCAGCCGTGACACGTTTTTACGATGTAAATCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	39.50%	0.04%	0.00%	NA
All Indica	2759	34.20%	65.70%	0.07%	0.00%	NA
All Japonica	1512	99.00%	1.00%	0.00%	0.00%	NA
Aus	269	96.70%	3.30%	0.00%	0.00%	NA
Indica I	595	18.80%	81.20%	0.00%	0.00%	NA
Indica II	465	50.30%	49.70%	0.00%	0.00%	NA
Indica III	913	36.10%	63.90%	0.00%	0.00%	NA
Indica Intermediate	786	34.00%	65.80%	0.25%	0.00%	NA
Temperate Japonica	767	98.80%	1.20%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506950500	G -> A	LOC_Os05g12160.1	upstream_gene_variant ; 1188.0bp to feature; MODIFIER	silent_mutation	Average:24.112; most accessible tissue: Callus, score: 44.826	N	N	N	N
vg0506950500	G -> A	LOC_Os05g12160-LOC_Os05g12170	intergenic_region ; MODIFIER	silent_mutation	Average:24.112; most accessible tissue: Callus, score: 44.826	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506950500	2.10E-07	NA	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506950500	1.11E-06	3.24E-11	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506950500	NA	1.08E-13	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506950500	NA	3.07E-10	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506950500	NA	5.00E-14	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506950500	NA	1.36E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506950500	8.93E-09	NA	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506950500	1.26E-07	1.02E-10	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506950500	NA	8.69E-12	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506950500	4.69E-06	1.21E-15	mr1593_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251