\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506946112:

Variant ID: vg0506946112 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6946112
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CACAAAAGTGACATAGTGAGGGTAGAAGTGGACTTGGAAAAGGTCTTGGTTTGGTCCCCAGTGAACTTCTTTGATTATCTATGCATTTCTTACACTTGGT[C/T]
TCTTTTCCTTCATCCAAACAAGTACATTTGCAAACGATAACATACGAAACTCATTGTGTAGTAACATTTATTTAAATATATAACAAGTAAATCTAATATA

Reverse complement sequence

TATATTAGATTTACTTGTTATATATTTAAATAAATGTTACTACACAATGAGTTTCGTATGTTATCGTTTGCAAATGTACTTGTTTGGATGAAGGAAAAGA[G/A]
ACCAAGTGTAAGAAATGCATAGATAATCAAAGAAGTTCACTGGGGACCAAACCAAGACCTTTTCCAAGTCCACTTCTACCCTCACTATGTCACTTTTGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.70% 0.06% 0.11% NA
All Indica  2759 88.60% 11.10% 0.11% 0.18% NA
All Japonica  1512 4.80% 95.20% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 96.00% 3.90% 0.17% 0.00% NA
Indica II  465 80.00% 19.60% 0.00% 0.43% NA
Indica III  913 89.50% 10.20% 0.11% 0.22% NA
Indica Intermediate  786 87.20% 12.60% 0.13% 0.13% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506946112 C -> T LOC_Os05g12150.1 upstream_gene_variant ; 1520.0bp to feature; MODIFIER silent_mutation Average:33.859; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0506946112 C -> T LOC_Os05g12160.1 downstream_gene_variant ; 2690.0bp to feature; MODIFIER silent_mutation Average:33.859; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0506946112 C -> T LOC_Os05g12150-LOC_Os05g12160 intergenic_region ; MODIFIER silent_mutation Average:33.859; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0506946112 C -> DEL N N silent_mutation Average:33.859; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506946112 2.57E-12 6.29E-43 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 7.02E-08 1.05E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 5.20E-06 6.52E-12 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 NA 2.60E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 1.20E-11 7.99E-45 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 3.50E-08 1.23E-13 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 2.30E-12 2.99E-53 mr1873 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 1.01E-06 1.03E-11 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 NA 4.84E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 6.39E-12 2.90E-45 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 1.60E-06 1.33E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 4.40E-11 3.95E-21 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 1.05E-06 7.59E-08 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 NA 1.36E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 6.05E-17 2.02E-59 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 1.38E-10 3.79E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 1.55E-09 4.28E-43 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112 6.80E-06 9.12E-09 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251