Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506946112:

Variant ID: vg0506946112 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6946112
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

CACAAAAGTGACATAGTGAGGGTAGAAGTGGACTTGGAAAAGGTCTTGGTTTGGTCCCCAGTGAACTTCTTTGATTATCTATGCATTTCTTACACTTGGT[C/T]
TCTTTTCCTTCATCCAAACAAGTACATTTGCAAACGATAACATACGAAACTCATTGTGTAGTAACATTTATTTAAATATATAACAAGTAAATCTAATATA

Reverse complement sequence

TATATTAGATTTACTTGTTATATATTTAAATAAATGTTACTACACAATGAGTTTCGTATGTTATCGTTTGCAAATGTACTTGTTTGGATGAAGGAAAAGA[G/A]
ACCAAGTGTAAGAAATGCATAGATAATCAAAGAAGTTCACTGGGGACCAAACCAAGACCTTTTCCAAGTCCACTTCTACCCTCACTATGTCACTTTTGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	41.70%	0.06%	0.11%	NA
All Indica	2759	88.60%	11.10%	0.11%	0.18%	NA
All Japonica	1512	4.80%	95.20%	0.00%	0.00%	NA
Aus	269	71.00%	29.00%	0.00%	0.00%	NA
Indica I	595	96.00%	3.90%	0.17%	0.00%	NA
Indica II	465	80.00%	19.60%	0.00%	0.43%	NA
Indica III	913	89.50%	10.20%	0.11%	0.22%	NA
Indica Intermediate	786	87.20%	12.60%	0.13%	0.13%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	5.60%	94.40%	0.00%	0.00%	NA
Japonica Intermediate	241	13.30%	86.70%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	43.30%	56.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506946112	C -> T	LOC_Os05g12150.1	upstream_gene_variant ; 1520.0bp to feature; MODIFIER	silent_mutation	Average:33.859; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg0506946112	C -> T	LOC_Os05g12160.1	downstream_gene_variant ; 2690.0bp to feature; MODIFIER	silent_mutation	Average:33.859; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg0506946112	C -> T	LOC_Os05g12150-LOC_Os05g12160	intergenic_region ; MODIFIER	silent_mutation	Average:33.859; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg0506946112	C -> DEL	N	N	silent_mutation	Average:33.859; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506946112	2.57E-12	6.29E-43	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	7.02E-08	1.05E-10	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	5.20E-06	6.52E-12	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	NA	2.60E-08	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	1.20E-11	7.99E-45	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	3.50E-08	1.23E-13	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	2.30E-12	2.99E-53	mr1873	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	1.01E-06	1.03E-11	mr1873	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	NA	4.84E-11	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	6.39E-12	2.90E-45	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	1.60E-06	1.33E-10	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	4.40E-11	3.95E-21	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	1.05E-06	7.59E-08	mr1514_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	NA	1.36E-08	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	6.05E-17	2.02E-59	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	1.38E-10	3.79E-16	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	1.55E-09	4.28E-43	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946112	6.80E-06	9.12E-09	mr1873_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251