\
| Variant ID: vg0506946105 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6946105 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 90. )
CCCACAACACAAAAGTGACATAGTGAGGGTAGAAGTGGACTTGGAAAAGGTCTTGGTTTGGTCCCCAGTGAACTTCTTTGATTATCTATGCATTTCTTAC[A/G]
CTTGGTCTCTTTTCCTTCATCCAAACAAGTACATTTGCAAACGATAACATACGAAACTCATTGTGTAGTAACATTTATTTAAATATATAACAAGTAAATC
GATTTACTTGTTATATATTTAAATAAATGTTACTACACAATGAGTTTCGTATGTTATCGTTTGCAAATGTACTTGTTTGGATGAAGGAAAAGAGACCAAG[T/C]
GTAAGAAATGCATAGATAATCAAAGAAGTTCACTGGGGACCAAACCAAGACCTTTTCCAAGTCCACTTCTACCCTCACTATGTCACTTTTGTGTTGTGGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 41.70% | 0.06% | 0.11% | NA |
| All Indica | 2759 | 88.50% | 11.20% | 0.11% | 0.18% | NA |
| All Japonica | 1512 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 4.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 80.00% | 19.60% | 0.00% | 0.43% | NA |
| Indica III | 913 | 89.50% | 10.20% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 87.00% | 12.70% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 56.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506946105 | A -> DEL | N | N | silent_mutation | Average:33.581; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0506946105 | A -> G | LOC_Os05g12150.1 | upstream_gene_variant ; 1513.0bp to feature; MODIFIER | silent_mutation | Average:33.581; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0506946105 | A -> G | LOC_Os05g12160.1 | downstream_gene_variant ; 2697.0bp to feature; MODIFIER | silent_mutation | Average:33.581; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0506946105 | A -> G | LOC_Os05g12150-LOC_Os05g12160 | intergenic_region ; MODIFIER | silent_mutation | Average:33.581; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506946105 | 8.32E-12 | 6.59E-43 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 9.62E-08 | 3.48E-11 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | NA | 2.71E-11 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | NA | 1.29E-06 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 3.92E-14 | 2.40E-47 | mr1632 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 1.46E-08 | 4.16E-14 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 7.49E-12 | 9.29E-52 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 3.94E-06 | 7.08E-11 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | NA | 3.25E-11 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 2.75E-12 | 3.47E-45 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 5.36E-07 | 5.33E-11 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 2.08E-11 | 2.83E-21 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 1.62E-07 | 3.11E-08 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | NA | 2.93E-07 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 2.10E-16 | 7.95E-58 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 1.00E-10 | 6.95E-16 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 3.02E-09 | 1.51E-42 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946105 | 3.55E-06 | 3.69E-09 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |