\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506946098:

Variant ID: vg0506946098 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6946098
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GGCATAGCCCACAACACAAAAGTGACATAGTGAGGGTAGAAGTGGACTTGGAAAAGGTCTTGGTTTGGTCCCCAGTGAACTTCTTTGATTATCTATGCAT[T/A]
TCTTACACTTGGTCTCTTTTCCTTCATCCAAACAAGTACATTTGCAAACGATAACATACGAAACTCATTGTGTAGTAACATTTATTTAAATATATAACAA

Reverse complement sequence

TTGTTATATATTTAAATAAATGTTACTACACAATGAGTTTCGTATGTTATCGTTTGCAAATGTACTTGTTTGGATGAAGGAAAAGAGACCAAGTGTAAGA[A/T]
ATGCATAGATAATCAAAGAAGTTCACTGGGGACCAAACCAAGACCTTTTCCAAGTCCACTTCTACCCTCACTATGTCACTTTTGTGTTGTGGGCTATGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.70% 0.06% 0.11% NA
All Indica  2759 88.50% 11.20% 0.11% 0.18% NA
All Japonica  1512 4.80% 95.20% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 95.80% 4.00% 0.17% 0.00% NA
Indica II  465 80.00% 19.60% 0.00% 0.43% NA
Indica III  913 89.40% 10.30% 0.11% 0.22% NA
Indica Intermediate  786 87.20% 12.60% 0.13% 0.13% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506946098 T -> DEL N N silent_mutation Average:33.581; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0506946098 T -> A LOC_Os05g12150.1 upstream_gene_variant ; 1506.0bp to feature; MODIFIER silent_mutation Average:33.581; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0506946098 T -> A LOC_Os05g12160.1 downstream_gene_variant ; 2704.0bp to feature; MODIFIER silent_mutation Average:33.581; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0506946098 T -> A LOC_Os05g12150-LOC_Os05g12160 intergenic_region ; MODIFIER silent_mutation Average:33.581; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506946098 8.22E-13 2.83E-43 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 3.14E-08 4.66E-11 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 NA 1.45E-11 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 NA 7.16E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 8.93E-12 9.61E-45 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 2.35E-08 1.51E-13 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 2.75E-11 1.65E-51 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 8.09E-06 2.15E-10 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 NA 8.52E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 8.14E-14 5.03E-46 mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 5.55E-08 2.89E-11 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 5.33E-12 2.08E-21 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 1.64E-07 3.30E-08 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 NA 4.28E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 1.94E-18 4.08E-60 mr1632_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 7.75E-12 9.73E-17 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 2.48E-09 1.25E-42 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506946098 7.37E-06 1.36E-08 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251