\
| Variant ID: vg0506946098 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6946098 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 90. )
GGCATAGCCCACAACACAAAAGTGACATAGTGAGGGTAGAAGTGGACTTGGAAAAGGTCTTGGTTTGGTCCCCAGTGAACTTCTTTGATTATCTATGCAT[T/A]
TCTTACACTTGGTCTCTTTTCCTTCATCCAAACAAGTACATTTGCAAACGATAACATACGAAACTCATTGTGTAGTAACATTTATTTAAATATATAACAA
TTGTTATATATTTAAATAAATGTTACTACACAATGAGTTTCGTATGTTATCGTTTGCAAATGTACTTGTTTGGATGAAGGAAAAGAGACCAAGTGTAAGA[A/T]
ATGCATAGATAATCAAAGAAGTTCACTGGGGACCAAACCAAGACCTTTTCCAAGTCCACTTCTACCCTCACTATGTCACTTTTGTGTTGTGGGCTATGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 41.70% | 0.06% | 0.11% | NA |
| All Indica | 2759 | 88.50% | 11.20% | 0.11% | 0.18% | NA |
| All Japonica | 1512 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 4.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 80.00% | 19.60% | 0.00% | 0.43% | NA |
| Indica III | 913 | 89.40% | 10.30% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 87.20% | 12.60% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 56.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506946098 | T -> DEL | N | N | silent_mutation | Average:33.581; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0506946098 | T -> A | LOC_Os05g12150.1 | upstream_gene_variant ; 1506.0bp to feature; MODIFIER | silent_mutation | Average:33.581; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0506946098 | T -> A | LOC_Os05g12160.1 | downstream_gene_variant ; 2704.0bp to feature; MODIFIER | silent_mutation | Average:33.581; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0506946098 | T -> A | LOC_Os05g12150-LOC_Os05g12160 | intergenic_region ; MODIFIER | silent_mutation | Average:33.581; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506946098 | 8.22E-13 | 2.83E-43 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 3.14E-08 | 4.66E-11 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | NA | 1.45E-11 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | NA | 7.16E-08 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 8.93E-12 | 9.61E-45 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 2.35E-08 | 1.51E-13 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 2.75E-11 | 1.65E-51 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 8.09E-06 | 2.15E-10 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | NA | 8.52E-11 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 8.14E-14 | 5.03E-46 | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 5.55E-08 | 2.89E-11 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 5.33E-12 | 2.08E-21 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 1.64E-07 | 3.30E-08 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | NA | 4.28E-08 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 1.94E-18 | 4.08E-60 | mr1632_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 7.75E-12 | 9.73E-17 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 2.48E-09 | 1.25E-42 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506946098 | 7.37E-06 | 1.36E-08 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |