\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506945693:

Variant ID: vg0506945693 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6945693
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCGGTATCTTTGATGATAGCTGACAAAATTCGCTCTATTTGAGGAAATTAGATCCCGATCTTTCGATAGGTATTGATAACTCTCGTGGAAACTTCACA[C/T]
ACACGATCCAGCTTCTGATCAACATGATCCAAACTCTGGTTATCAGCCGTGCCCTACTCAGTTGACCTCGCCGAGAAGACTAATCCTTGTATGCAAATCG

Reverse complement sequence

CGATTTGCATACAAGGATTAGTCTTCTCGGCGAGGTCAACTGAGTAGGGCACGGCTGATAACCAGAGTTTGGATCATGTTGATCAGAAGCTGGATCGTGT[G/A]
TGTGAAGTTTCCACGAGAGTTATCAATACCTATCGAAAGATCGGGATCTAATTTCCTCAAATAGAGCGAATTTTGTCAGCTATCATCAAAGATACCGATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 41.70% 0.08% 0.00% NA
All Indica  2759 88.70% 11.20% 0.14% 0.00% NA
All Japonica  1512 4.80% 95.20% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 80.00% 19.60% 0.43% 0.00% NA
Indica III  913 89.50% 10.40% 0.11% 0.00% NA
Indica Intermediate  786 87.30% 12.60% 0.13% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506945693 C -> T LOC_Os05g12150.1 upstream_gene_variant ; 1101.0bp to feature; MODIFIER silent_mutation Average:45.826; most accessible tissue: Callus, score: 71.495 N N N N
vg0506945693 C -> T LOC_Os05g12160.1 downstream_gene_variant ; 3109.0bp to feature; MODIFIER silent_mutation Average:45.826; most accessible tissue: Callus, score: 71.495 N N N N
vg0506945693 C -> T LOC_Os05g12150-LOC_Os05g12160 intergenic_region ; MODIFIER silent_mutation Average:45.826; most accessible tissue: Callus, score: 71.495 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506945693 7.25E-10 1.06E-41 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 5.42E-06 9.42E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 8.82E-06 8.86E-12 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 NA 4.01E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 6.03E-11 1.74E-44 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 1.05E-07 2.59E-13 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 4.12E-12 1.06E-52 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 2.35E-06 3.49E-11 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 NA 4.25E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 3.51E-11 1.47E-43 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 2.10E-06 2.87E-09 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 2.09E-09 4.82E-20 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 NA 1.07E-06 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 NA 1.15E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 5.04E-18 4.32E-59 mr1632_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 3.80E-11 1.54E-15 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 1.58E-09 4.67E-42 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506945693 9.07E-06 1.18E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251