Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506943710:

Variant ID: vg0506943710 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6943710
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCCCGGTACTTGTCGGCGAACTCGAACAGCTGAACGCGCCACAAAATTTTCAGAGGAAATTTCGTTTGATTTCGAGCTCATTTGCGAGAGTTCTTGGA[G/A]
TGTTTGGATGACCGACCTGCTTGGAGTGCACAAGGAGGAGGTTGGCGTAGCCAGGGTACGTGCCGCGGAAGACGATGGACGCGGCGGCCATGGCGGCGGC

Reverse complement sequence

GCCGCCGCCATGGCCGCCGCGTCCATCGTCTTCCGCGGCACGTACCCTGGCTACGCCAACCTCCTCCTTGTGCACTCCAAGCAGGTCGGTCATCCAAACA[C/T]
TCCAAGAACTCTCGCAAATGAGCTCGAAATCAAACGAAATTTCCTCTGAAAATTTTGTGGCGCGTTCAGCTGTTCGAGTTCGCCGACAAGTACCGGGGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.90% 19.40% 3.07% 35.63% NA
All Indica  2759 11.40% 28.60% 4.68% 55.31% NA
All Japonica  1512 95.20% 1.60% 0.33% 2.84% NA
Aus  269 29.00% 33.50% 2.60% 34.94% NA
Indica I  595 3.90% 38.30% 12.10% 45.71% NA
Indica II  465 20.20% 29.70% 2.58% 47.53% NA
Indica III  913 10.40% 19.20% 1.31% 69.11% NA
Indica Intermediate  786 13.00% 31.70% 4.20% 51.15% NA
Temperate Japonica  767 98.40% 0.40% 0.13% 1.04% NA
Tropical Japonica  504 94.40% 1.80% 0.60% 3.17% NA
Japonica Intermediate  241 86.70% 5.00% 0.41% 7.88% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 57.80% 14.40% 4.44% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506943710 G -> DEL N N silent_mutation Average:87.789; most accessible tissue: Minghui63 flag leaf, score: 92.302 N N N N
vg0506943710 G -> A LOC_Os05g12140.1 upstream_gene_variant ; 3939.0bp to feature; MODIFIER silent_mutation Average:87.789; most accessible tissue: Minghui63 flag leaf, score: 92.302 N N N N
vg0506943710 G -> A LOC_Os05g12140.2 upstream_gene_variant ; 3939.0bp to feature; MODIFIER silent_mutation Average:87.789; most accessible tissue: Minghui63 flag leaf, score: 92.302 N N N N
vg0506943710 G -> A LOC_Os05g12150.1 intron_variant ; MODIFIER silent_mutation Average:87.789; most accessible tissue: Minghui63 flag leaf, score: 92.302 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0506943710 G A -0.02 -0.02 -0.04 -0.04 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506943710 4.36E-11 1.25E-42 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 7.10E-08 7.33E-12 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 NA 3.26E-10 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 NA 9.54E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 2.00E-10 7.21E-43 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 4.41E-07 7.89E-13 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 7.98E-09 3.43E-47 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 NA 6.26E-10 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 NA 2.41E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 4.09E-13 9.45E-45 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 8.97E-09 1.54E-11 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 5.99E-12 2.21E-21 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 1.01E-08 1.98E-09 mr1514_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 NA 7.18E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 4.78E-16 1.19E-56 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 9.39E-12 1.10E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 4.97E-08 9.32E-41 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506943710 NA 7.37E-08 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251