\
| Variant ID: vg0506936871 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6936871 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 104. )
TTTTTAAAATGAATATCGCTAATATGTCCACAGCCAAACAGTTCAACGTTAGAGGGAAATCTAATCTCAGCATTCCCCTTTATTGTGTACCGTAGAAAAC[G/A]
TCCAGAGATAATTTAGTAGATAAAGAGTTTTGATATGATTTATATTGCATATAACATCCTAGGAAATACAGACAAGCGGACATGTAAAACAATACAAGAT
ATCTTGTATTGTTTTACATGTCCGCTTGTCTGTATTTCCTAGGATGTTATATGCAATATAAATCATATCAAAACTCTTTATCTACTAAATTATCTCTGGA[C/T]
GTTTTCTACGGTACACAATAAAGGGGAATGCTGAGATTAGATTTCCCTCTAACGTTGAACTGTTTGGCTGTGGACATATTAGCGATATTCATTTTAAAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 41.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 88.40% | 11.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.00% | 10.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 87.00% | 13.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 55.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506936871 | G -> A | LOC_Os05g12140.1 | 3_prime_UTR_variant ; 423.0bp to feature; MODIFIER | silent_mutation | Average:61.421; most accessible tissue: Callus, score: 80.654 | N | N | N | N |
| vg0506936871 | G -> A | LOC_Os05g12140.2 | 3_prime_UTR_variant ; 423.0bp to feature; MODIFIER | silent_mutation | Average:61.421; most accessible tissue: Callus, score: 80.654 | N | N | N | N |
| vg0506936871 | G -> A | LOC_Os05g12130.1 | downstream_gene_variant ; 280.0bp to feature; MODIFIER | silent_mutation | Average:61.421; most accessible tissue: Callus, score: 80.654 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506936871 | 2.52E-11 | 9.22E-41 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | 5.70E-08 | 5.13E-10 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | NA | 2.55E-11 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | NA | 2.72E-08 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | 2.52E-09 | 1.66E-42 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | 5.28E-07 | 5.72E-13 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | 7.91E-10 | 3.76E-49 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | NA | 3.75E-10 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | NA | 1.66E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | NA | 4.28E-12 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | 7.30E-13 | 3.90E-44 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | 1.34E-09 | 3.81E-11 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | 1.68E-09 | 1.36E-19 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | 2.21E-06 | 2.00E-07 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | NA | 1.14E-07 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | 1.11E-16 | 9.89E-58 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | 1.39E-12 | 1.19E-16 | mr1632_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | 1.76E-08 | 1.85E-40 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506936871 | 2.62E-06 | 1.76E-08 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |