\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506900331:

Variant ID: vg0506900331 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6900331
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGCTTAGTTGAAAACCTAGCAGGAGTAGCCATGGCAAAAACTCTAGATCGATAAAAGTCCAAAGAAGAAAACAAGGCTCTGATACCACTTGTAGGATC[G/A]
AATCACAATAACTAAGCCAACCAGAGGGGGGTGAATGGTTGGTATACCCAAAAACTGAAAACTTTTAGCGGAAATAAAAGTTACCTTCGAATTTGACGGA

Reverse complement sequence

TCCGTCAAATTCGAAGGTAACTTTTATTTCCGCTAAAAGTTTTCAGTTTTTGGGTATACCAACCATTCACCCCCCTCTGGTTGGCTTAGTTATTGTGATT[C/T]
GATCCTACAAGTGGTATCAGAGCCTTGTTTTCTTCTTTGGACTTTTATCGATCTAGAGTTTTTGCCATGGCTACTCCTGCTAGGTTTTCAACTAAGCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.00% 27.30% 4.21% 36.54% NA
All Indica  2759 27.20% 11.30% 6.45% 54.98% NA
All Japonica  1512 45.30% 50.50% 0.20% 3.97% NA
Aus  269 19.30% 29.00% 5.58% 46.10% NA
Indica I  595 21.00% 5.20% 15.46% 58.32% NA
Indica II  465 32.70% 18.90% 2.80% 45.59% NA
Indica III  913 34.50% 10.30% 3.07% 52.14% NA
Indica Intermediate  786 20.20% 12.70% 5.73% 61.32% NA
Temperate Japonica  767 78.70% 19.90% 0.00% 1.30% NA
Tropical Japonica  504 6.90% 88.70% 0.40% 3.97% NA
Japonica Intermediate  241 19.10% 68.00% 0.41% 12.45% NA
VI/Aromatic  96 0.00% 99.00% 0.00% 1.04% NA
Intermediate  90 25.60% 43.30% 3.33% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506900331 G -> DEL N N silent_mutation Average:7.234; most accessible tissue: Callus, score: 15.168 N N N N
vg0506900331 G -> A LOC_Os05g12060.1 upstream_gene_variant ; 67.0bp to feature; MODIFIER silent_mutation Average:7.234; most accessible tissue: Callus, score: 15.168 N N N N
vg0506900331 G -> A LOC_Os05g12070.1 upstream_gene_variant ; 3773.0bp to feature; MODIFIER silent_mutation Average:7.234; most accessible tissue: Callus, score: 15.168 N N N N
vg0506900331 G -> A LOC_Os05g12060-LOC_Os05g12070 intergenic_region ; MODIFIER silent_mutation Average:7.234; most accessible tissue: Callus, score: 15.168 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506900331 NA 9.20E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506900331 1.63E-06 NA mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 4.10E-09 5.40E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 NA 8.44E-06 mr1514 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 NA 1.50E-18 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 NA 9.84E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 4.10E-07 2.21E-22 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 5.25E-06 NA mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 5.75E-07 4.12E-12 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 NA 6.86E-09 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 2.25E-09 6.09E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 NA 1.11E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 7.61E-06 1.69E-06 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 NA 6.23E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 NA 8.49E-25 mr1593_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 NA 5.83E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 1.59E-07 7.27E-30 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 2.87E-08 NA mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 1.07E-11 4.50E-15 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506900331 NA 1.67E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251