\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506898674:

Variant ID: vg0506898674 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6898674
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGAATTTTTCAAATAAGAAACCTCTTTTTCCAAATTAGCACAATTTTCACAATTTACCATGACACCTTTGCTTTTATGACACTTGGGGCAAGAAAGCA[C/T]
TTCATTGTTTTTCATAACATTTTCCATGTACTCAACACGACCTAAAGCATCTTTTAAATTCATCTTATTCAAATTACATGTTGAGCAATCCAAAACATCA

Reverse complement sequence

TGATGTTTTGGATTGCTCAACATGTAATTTGAATAAGATGAATTTAAAAGATGCTTTAGGTCGTGTTGAGTACATGGAAAATGTTATGAAAAACAATGAA[G/A]
TGCTTTCTTGCCCCAAGTGTCATAAAAGCAAAGGTGTCATGGTAAATTGTGAAAATTGTGCTAATTTGGAAAAAGAGGTTTCTTATTTGAAAAATTCTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.30% 15.80% 11.19% 44.69% NA
All Indica  2759 12.80% 1.70% 13.05% 72.49% NA
All Japonica  1512 50.40% 45.00% 1.65% 2.98% NA
Aus  269 31.20% 3.00% 50.56% 15.24% NA
Indica I  595 6.90% 1.00% 7.39% 84.71% NA
Indica II  465 19.80% 2.40% 12.04% 65.81% NA
Indica III  913 11.10% 1.20% 15.66% 72.07% NA
Indica Intermediate  786 15.10% 2.30% 14.89% 67.68% NA
Temperate Japonica  767 19.90% 78.50% 0.13% 1.43% NA
Tropical Japonica  504 88.50% 6.20% 2.38% 2.98% NA
Japonica Intermediate  241 67.60% 19.50% 4.98% 7.88% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 46.70% 16.70% 8.89% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506898674 C -> T LOC_Os05g12060.1 missense_variant ; p.Val521Met; MODERATE nonsynonymous_codon ; V521M Average:7.877; most accessible tissue: Minghui63 root, score: 13.235 probably damaging 2.175 DELETERIOUS 0.00
vg0506898674 C -> DEL LOC_Os05g12060.1 N frameshift_variant Average:7.877; most accessible tissue: Minghui63 root, score: 13.235 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506898674 3.58E-06 6.66E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 1.09E-07 3.44E-21 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 NA 6.88E-09 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 5.81E-07 8.71E-21 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 2.03E-06 NA mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 2.59E-06 6.31E-12 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 NA 5.81E-10 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 4.08E-07 NA mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 7.05E-10 4.36E-11 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 NA 1.52E-07 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 NA 4.70E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 NA 9.16E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 2.24E-06 3.33E-26 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 NA 3.92E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 1.23E-06 1.13E-26 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 8.21E-11 NA mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 1.08E-12 5.13E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 NA 1.86E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 6.71E-06 NA mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506898674 1.48E-09 5.34E-11 mr1873_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251