Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506893511:

Variant ID: vg0506893511 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6893511
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CACCTGTAAATCCAATCATCTCCAAAACTACTTCGTGAATTAATTCCAAATAACAAAACCAATTATCTCCGATGCCAATTGTTCATCACAGAATAATAAT[C/A]
AAAAACACCTTTGATTTTACAATCTCCCCCTTGATGAACACATTGGCAAACCCATCAAAAATGTTTTAGTGTTTGGAAAAATAAAAACAAAAGTGGTAAA

Reverse complement sequence

TTTACCACTTTTGTTTTTATTTTTCCAAACACTAAAACATTTTTGATGGGTTTGCCAATGTGTTCATCAAGGGGGAGATTGTAAAATCAAAGGTGTTTTT[G/T]
ATTATTATTCTGTGATGAACAATTGGCATCGGAGATAATTGGTTTTGTTATTTGGAATTAATTCACGAAGTAGTTTTGGAGATGATTGGATTTACAGGTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.00%	17.50%	31.49%	24.06%	NA
All Indica	2759	12.10%	4.70%	46.28%	36.97%	NA
All Japonica	1512	48.20%	44.80%	4.17%	2.84%	NA
Aus	269	29.40%	0.70%	50.19%	19.70%	NA
Indica I	595	5.90%	3.40%	40.17%	50.59%	NA
Indica II	465	19.60%	4.30%	37.85%	38.28%	NA
Indica III	913	10.70%	5.90%	56.52%	26.83%	NA
Indica Intermediate	786	13.90%	4.50%	44.02%	37.66%	NA
Temperate Japonica	767	17.30%	78.20%	3.39%	1.04%	NA
Tropical Japonica	504	86.50%	6.20%	4.96%	2.38%	NA
Japonica Intermediate	241	66.40%	19.10%	4.98%	9.54%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	44.40%	18.90%	14.44%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506893511	C -> DEL	N	N	silent_mutation	Average:17.573; most accessible tissue: Callus, score: 35.499	N	N	N	N
vg0506893511	C -> A	LOC_Os05g12050.1	downstream_gene_variant ; 4149.0bp to feature; MODIFIER	silent_mutation	Average:17.573; most accessible tissue: Callus, score: 35.499	N	N	N	N
vg0506893511	C -> A	LOC_Os05g12060.1	downstream_gene_variant ; 1096.0bp to feature; MODIFIER	silent_mutation	Average:17.573; most accessible tissue: Callus, score: 35.499	N	N	N	N
vg0506893511	C -> A	LOC_Os05g12050-LOC_Os05g12060	intergenic_region ; MODIFIER	silent_mutation	Average:17.573; most accessible tissue: Callus, score: 35.499	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506893511	1.21E-07	1.17E-09	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	4.35E-07	6.78E-20	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	NA	3.86E-08	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	3.03E-06	8.04E-18	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	4.04E-07	2.69E-12	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	NA	1.32E-07	mr1873	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	4.67E-08	NA	mr1039_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	1.68E-11	7.48E-10	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	NA	3.74E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	2.13E-06	2.28E-07	mr1514_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	NA	1.42E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	NA	7.06E-23	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	NA	5.52E-08	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	1.40E-09	NA	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	5.38E-11	3.96E-14	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511	NA	7.20E-07	mr1873_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251