\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506893511:

Variant ID: vg0506893511 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6893511
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CACCTGTAAATCCAATCATCTCCAAAACTACTTCGTGAATTAATTCCAAATAACAAAACCAATTATCTCCGATGCCAATTGTTCATCACAGAATAATAAT[C/A]
AAAAACACCTTTGATTTTACAATCTCCCCCTTGATGAACACATTGGCAAACCCATCAAAAATGTTTTAGTGTTTGGAAAAATAAAAACAAAAGTGGTAAA

Reverse complement sequence

TTTACCACTTTTGTTTTTATTTTTCCAAACACTAAAACATTTTTGATGGGTTTGCCAATGTGTTCATCAAGGGGGAGATTGTAAAATCAAAGGTGTTTTT[G/T]
ATTATTATTCTGTGATGAACAATTGGCATCGGAGATAATTGGTTTTGTTATTTGGAATTAATTCACGAAGTAGTTTTGGAGATGATTGGATTTACAGGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.00% 17.50% 31.49% 24.06% NA
All Indica  2759 12.10% 4.70% 46.28% 36.97% NA
All Japonica  1512 48.20% 44.80% 4.17% 2.84% NA
Aus  269 29.40% 0.70% 50.19% 19.70% NA
Indica I  595 5.90% 3.40% 40.17% 50.59% NA
Indica II  465 19.60% 4.30% 37.85% 38.28% NA
Indica III  913 10.70% 5.90% 56.52% 26.83% NA
Indica Intermediate  786 13.90% 4.50% 44.02% 37.66% NA
Temperate Japonica  767 17.30% 78.20% 3.39% 1.04% NA
Tropical Japonica  504 86.50% 6.20% 4.96% 2.38% NA
Japonica Intermediate  241 66.40% 19.10% 4.98% 9.54% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 44.40% 18.90% 14.44% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506893511 C -> DEL N N silent_mutation Average:17.573; most accessible tissue: Callus, score: 35.499 N N N N
vg0506893511 C -> A LOC_Os05g12050.1 downstream_gene_variant ; 4149.0bp to feature; MODIFIER silent_mutation Average:17.573; most accessible tissue: Callus, score: 35.499 N N N N
vg0506893511 C -> A LOC_Os05g12060.1 downstream_gene_variant ; 1096.0bp to feature; MODIFIER silent_mutation Average:17.573; most accessible tissue: Callus, score: 35.499 N N N N
vg0506893511 C -> A LOC_Os05g12050-LOC_Os05g12060 intergenic_region ; MODIFIER silent_mutation Average:17.573; most accessible tissue: Callus, score: 35.499 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506893511 1.21E-07 1.17E-09 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 4.35E-07 6.78E-20 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 NA 3.86E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 3.03E-06 8.04E-18 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 4.04E-07 2.69E-12 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 NA 1.32E-07 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 4.67E-08 NA mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 1.68E-11 7.48E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 NA 3.74E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 2.13E-06 2.28E-07 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 NA 1.42E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 NA 7.06E-23 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 NA 5.52E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 1.40E-09 NA mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 5.38E-11 3.96E-14 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506893511 NA 7.20E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251