\
| Variant ID: vg0506884765 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6884765 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 122. )
TGGTGGCGGATGAATTCCACCGGGCCATTGGCGAGAAGCGATGGTAAAACCCCTACAAGAGGAGCTCCACGGGCCAAGGGTGGAGGCGGTGGTCTAGAGA[A/T]
TTTTGTGCCAGTGGTTCTTGTTCTTTCTCTTGTTGCAATCTTACTCAACATTGTTGCAGCGACGAACAGTTGAGCCAGGAACAACCATATGGCTCCTGTT
AACAGGAGCCATATGGTTGTTCCTGGCTCAACTGTTCGTCGCTGCAACAATGTTGAGTAAGATTGCAACAAGAGAAAGAACAAGAACCACTGGCACAAAA[T/A]
TCTCTAGACCACCGCCTCCACCCTTGGCCCGTGGAGCTCCTCTTGTAGGGGTTTTACCATCGCTTCTCGCCAATGGCCCGGTGGAATTCATCCGCCACCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 46.10% | 0.15% | 0.06% | NA |
| All Indica | 2759 | 29.70% | 70.00% | 0.22% | 0.11% | NA |
| All Japonica | 1512 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 30.10% | 69.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 10.60% | 89.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 50.10% | 49.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 35.70% | 63.90% | 0.22% | 0.22% | NA |
| Indica Intermediate | 786 | 25.10% | 74.60% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506884765 | A -> T | LOC_Os05g12040.1 | missense_variant ; p.Phe38Ile; MODERATE | nonsynonymous_codon ; F38I | Average:58.421; most accessible tissue: Callus, score: 75.097 | unknown | unknown | TOLERATED | 0.47 |
| vg0506884765 | A -> DEL | LOC_Os05g12040.1 | N | frameshift_variant | Average:58.421; most accessible tissue: Callus, score: 75.097 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506884765 | 3.13E-16 | NA | mr1039 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506884765 | 3.54E-15 | 1.26E-18 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506884765 | NA | 3.56E-15 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506884765 | NA | 3.60E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506884765 | 1.11E-19 | NA | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506884765 | 4.88E-18 | 3.44E-19 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506884765 | NA | 6.05E-14 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506884765 | 3.75E-06 | NA | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506884765 | 2.39E-07 | 2.14E-07 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506884765 | NA | 4.12E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |