\
| Variant ID: vg0506882601 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6882601 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 111. )
CCATCCGTCCCAAATATAAGAAGTATTTTAGAAAATCATGAGCTACAATTAAGAGTCCGATCATCTCAAGTTAACATGCGAGTTTTTTTTAAATAGATTT[T/C]
TTATACGACTCCTTCTGTATTTTTAAAAACAAACGAACTTAAAAACTGACTCAAATACGGATATGTATTTCCAAAAGCGAACAAACTTAATTAAAAACTG
CAGTTTTTAATTAAGTTTGTTCGCTTTTGGAAATACATATCCGTATTTGAGTCAGTTTTTAAGTTCGTTTGTTTTTAAAAATACAGAAGGAGTCGTATAA[A/G]
AAATCTATTTAAAAAAAACTCGCATGTTAACTTGAGATGATCGGACTCTTAATTGTAGCTCATGATTTTCTAAAATACTTCTTATATTTGGGACGGATGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.80% | 42.20% | 0.02% | 1.02% | NA |
| All Indica | 2759 | 86.50% | 11.80% | 0.04% | 1.67% | NA |
| All Japonica | 1512 | 4.70% | 95.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.80% | 4.90% | 0.00% | 0.34% | NA |
| Indica II | 465 | 75.50% | 20.20% | 0.00% | 4.30% | NA |
| Indica III | 913 | 87.30% | 10.70% | 0.11% | 1.86% | NA |
| Indica Intermediate | 786 | 85.80% | 13.40% | 0.00% | 0.89% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.90% | 87.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 58.90% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506882601 | T -> DEL | N | N | silent_mutation | Average:39.597; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0506882601 | T -> C | LOC_Os05g12030.1 | downstream_gene_variant ; 341.0bp to feature; MODIFIER | silent_mutation | Average:39.597; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0506882601 | T -> C | LOC_Os05g12040.1 | downstream_gene_variant ; 62.0bp to feature; MODIFIER | silent_mutation | Average:39.597; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0506882601 | T -> C | LOC_Os05g12030-LOC_Os05g12040 | intergenic_region ; MODIFIER | silent_mutation | Average:39.597; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506882601 | 9.40E-12 | 1.99E-41 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 2.84E-08 | 3.71E-10 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 1.79E-07 | 3.71E-13 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 3.98E-06 | 5.45E-07 | mr1514 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | NA | 8.35E-09 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 2.06E-10 | 4.89E-43 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 1.62E-07 | 7.53E-13 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 4.44E-11 | 1.12E-51 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 1.19E-06 | 1.14E-11 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | NA | 1.83E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 8.45E-13 | 4.56E-44 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 4.53E-08 | 2.93E-10 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 2.35E-11 | 1.23E-20 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 4.27E-07 | 6.37E-08 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | NA | 1.48E-08 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 2.53E-17 | 9.48E-58 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 1.39E-11 | 8.45E-16 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | 3.94E-08 | 1.69E-40 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506882601 | NA | 3.57E-07 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |