\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506882601:

Variant ID: vg0506882601 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6882601
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


CCATCCGTCCCAAATATAAGAAGTATTTTAGAAAATCATGAGCTACAATTAAGAGTCCGATCATCTCAAGTTAACATGCGAGTTTTTTTTAAATAGATTT[T/C]
TTATACGACTCCTTCTGTATTTTTAAAAACAAACGAACTTAAAAACTGACTCAAATACGGATATGTATTTCCAAAAGCGAACAAACTTAATTAAAAACTG

Reverse complement sequence

CAGTTTTTAATTAAGTTTGTTCGCTTTTGGAAATACATATCCGTATTTGAGTCAGTTTTTAAGTTCGTTTGTTTTTAAAAATACAGAAGGAGTCGTATAA[A/G]
AAATCTATTTAAAAAAAACTCGCATGTTAACTTGAGATGATCGGACTCTTAATTGTAGCTCATGATTTTCTAAAATACTTCTTATATTTGGGACGGATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 42.20% 0.02% 1.02% NA
All Indica  2759 86.50% 11.80% 0.04% 1.67% NA
All Japonica  1512 4.70% 95.30% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 94.80% 4.90% 0.00% 0.34% NA
Indica II  465 75.50% 20.20% 0.00% 4.30% NA
Indica III  913 87.30% 10.70% 0.11% 1.86% NA
Indica Intermediate  786 85.80% 13.40% 0.00% 0.89% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 12.90% 87.10% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 38.90% 58.90% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506882601 T -> DEL N N silent_mutation Average:39.597; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0506882601 T -> C LOC_Os05g12030.1 downstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:39.597; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0506882601 T -> C LOC_Os05g12040.1 downstream_gene_variant ; 62.0bp to feature; MODIFIER silent_mutation Average:39.597; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0506882601 T -> C LOC_Os05g12030-LOC_Os05g12040 intergenic_region ; MODIFIER silent_mutation Average:39.597; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506882601 9.40E-12 1.99E-41 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 2.84E-08 3.71E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 1.79E-07 3.71E-13 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 3.98E-06 5.45E-07 mr1514 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 NA 8.35E-09 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 2.06E-10 4.89E-43 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 1.62E-07 7.53E-13 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 4.44E-11 1.12E-51 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 1.19E-06 1.14E-11 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 NA 1.83E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 8.45E-13 4.56E-44 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 4.53E-08 2.93E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 2.35E-11 1.23E-20 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 4.27E-07 6.37E-08 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 NA 1.48E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 2.53E-17 9.48E-58 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 1.39E-11 8.45E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 3.94E-08 1.69E-40 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882601 NA 3.57E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251