\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506882545:

Variant ID: vg0506882545 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6882545
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTTATATAGTTTAGTTAAGGTGAAATTCACAGTCAGAATTTGCTTGGATATACTCCATCCGTCCCAAATATAAGAAGTATTTTAGAAAATCATGAGCT[A/G]
CAATTAAGAGTCCGATCATCTCAAGTTAACATGCGAGTTTTTTTTAAATAGATTTTTTATACGACTCCTTCTGTATTTTTAAAAACAAACGAACTTAAAA

Reverse complement sequence

TTTTAAGTTCGTTTGTTTTTAAAAATACAGAAGGAGTCGTATAAAAAATCTATTTAAAAAAAACTCGCATGTTAACTTGAGATGATCGGACTCTTAATTG[T/C]
AGCTCATGATTTTCTAAAATACTTCTTATATTTGGGACGGATGGAGTATATCCAAGCAAATTCTGACTGTGAATTTCACCTTAACTAAACTATATAACCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 42.20% 0.13% 0.00% NA
All Indica  2759 87.90% 11.90% 0.18% 0.00% NA
All Japonica  1512 4.80% 95.20% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 95.30% 4.50% 0.17% 0.00% NA
Indica II  465 79.80% 20.20% 0.00% 0.00% NA
Indica III  913 88.70% 11.20% 0.11% 0.00% NA
Indica Intermediate  786 86.30% 13.40% 0.38% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 97.90% 1.04% 0.00% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506882545 A -> G LOC_Os05g12030.1 downstream_gene_variant ; 285.0bp to feature; MODIFIER silent_mutation Average:41.582; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0506882545 A -> G LOC_Os05g12040.1 downstream_gene_variant ; 118.0bp to feature; MODIFIER silent_mutation Average:41.582; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0506882545 A -> G LOC_Os05g12030-LOC_Os05g12040 intergenic_region ; MODIFIER silent_mutation Average:41.582; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506882545 5.58E-12 7.44E-42 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 1.32E-08 1.32E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 1.39E-06 2.18E-12 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 NA 7.38E-06 mr1514 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 NA 5.29E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 1.23E-11 7.49E-45 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 6.71E-09 1.15E-14 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 1.15E-11 2.24E-52 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 1.88E-07 2.55E-12 mr1873 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 NA 3.96E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 NA 7.42E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 5.39E-12 1.23E-43 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 1.24E-07 4.63E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 2.93E-11 1.39E-20 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 3.33E-07 5.86E-08 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 NA 1.56E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 1.27E-15 2.14E-56 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 3.09E-10 9.10E-15 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 1.27E-08 2.36E-41 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545 NA 7.43E-08 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251