Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506882545:

Variant ID: vg0506882545 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6882545
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

GGGTTATATAGTTTAGTTAAGGTGAAATTCACAGTCAGAATTTGCTTGGATATACTCCATCCGTCCCAAATATAAGAAGTATTTTAGAAAATCATGAGCT[A/G]
CAATTAAGAGTCCGATCATCTCAAGTTAACATGCGAGTTTTTTTTAAATAGATTTTTTATACGACTCCTTCTGTATTTTTAAAAACAAACGAACTTAAAA

Reverse complement sequence

TTTTAAGTTCGTTTGTTTTTAAAAATACAGAAGGAGTCGTATAAAAAATCTATTTAAAAAAAACTCGCATGTTAACTTGAGATGATCGGACTCTTAATTG[T/C]
AGCTCATGATTTTCTAAAATACTTCTTATATTTGGGACGGATGGAGTATATCCAAGCAAATTCTGACTGTGAATTTCACCTTAACTAAACTATATAACCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.70%	42.20%	0.13%	0.00%	NA
All Indica	2759	87.90%	11.90%	0.18%	0.00%	NA
All Japonica	1512	4.80%	95.20%	0.00%	0.00%	NA
Aus	269	71.00%	29.00%	0.00%	0.00%	NA
Indica I	595	95.30%	4.50%	0.17%	0.00%	NA
Indica II	465	79.80%	20.20%	0.00%	0.00%	NA
Indica III	913	88.70%	11.20%	0.11%	0.00%	NA
Indica Intermediate	786	86.30%	13.40%	0.38%	0.00%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	5.60%	94.40%	0.00%	0.00%	NA
Japonica Intermediate	241	13.30%	86.70%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	97.90%	1.04%	0.00%	NA
Intermediate	90	41.10%	58.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506882545	A -> G	LOC_Os05g12030.1	downstream_gene_variant ; 285.0bp to feature; MODIFIER	silent_mutation	Average:41.582; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg0506882545	A -> G	LOC_Os05g12040.1	downstream_gene_variant ; 118.0bp to feature; MODIFIER	silent_mutation	Average:41.582; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg0506882545	A -> G	LOC_Os05g12030-LOC_Os05g12040	intergenic_region ; MODIFIER	silent_mutation	Average:41.582; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506882545	5.58E-12	7.44E-42	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	1.32E-08	1.32E-10	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	1.39E-06	2.18E-12	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	NA	7.38E-06	mr1514	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	NA	5.29E-08	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	1.23E-11	7.49E-45	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	6.71E-09	1.15E-14	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	1.15E-11	2.24E-52	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	1.88E-07	2.55E-12	mr1873	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	NA	3.96E-11	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	NA	7.42E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	5.39E-12	1.23E-43	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	1.24E-07	4.63E-10	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	2.93E-11	1.39E-20	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	3.33E-07	5.86E-08	mr1514_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	NA	1.56E-08	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	1.27E-15	2.14E-56	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	3.09E-10	9.10E-15	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	1.27E-08	2.36E-41	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506882545	NA	7.43E-08	mr1873_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251