\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506874665:

Variant ID: vg0506874665 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6874665
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGAAAGATCCATTTCGCCCGTATGGAAAAAGCTCTTCTGTACTAGTGAAATATTCAACTAGGTGCATGTCTCGCGGCGAAATACAATTGAAAGAGGAT[T/C]
TGGGGTAACGAAAAAGCTGTGGAAAATTCTTAATGGAATCCTGTATTACCGCAACCCAAACATTCAGACCAACATAACACATGCAGTTTGAGTAAATTCC

Reverse complement sequence

GGAATTTACTCAAACTGCATGTGTTATGTTGGTCTGAATGTTTGGGTTGCGGTAATACAGGATTCCATTAAGAATTTTCCACAGCTTTTTCGTTACCCCA[A/G]
ATCCTCTTTCAATTGTATTTCGCCGCGAGACATGCACCTAGTTGAATATTTCACTAGTACAGAAGAGCTTTTTCCATACGGGCGAAATGGATCTTTCCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 49.30% 0.08% 0.00% NA
All Indica  2759 83.20% 16.70% 0.11% 0.00% NA
All Japonica  1512 2.50% 97.50% 0.00% 0.00% NA
Aus  269 10.00% 90.00% 0.00% 0.00% NA
Indica I  595 92.10% 7.90% 0.00% 0.00% NA
Indica II  465 79.60% 20.40% 0.00% 0.00% NA
Indica III  913 84.40% 15.40% 0.11% 0.00% NA
Indica Intermediate  786 77.20% 22.50% 0.25% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 4.20% 95.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 35.60% 63.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506874665 T -> C LOC_Os05g12030.1 upstream_gene_variant ; 3552.0bp to feature; MODIFIER silent_mutation Average:48.616; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg0506874665 T -> C LOC_Os05g12020.1 intron_variant ; MODIFIER silent_mutation Average:48.616; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506874665 3.83E-13 2.35E-38 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 6.68E-10 2.41E-11 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 NA 2.24E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 NA 2.66E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 9.64E-06 1.20E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 NA 3.63E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 2.64E-12 2.62E-35 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 1.79E-09 4.34E-12 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 6.77E-09 NA mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 8.96E-06 2.57E-09 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 5.09E-18 2.74E-43 mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 1.70E-12 5.21E-12 mr1039_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 7.56E-09 1.60E-21 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 4.36E-06 9.39E-07 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 NA 8.79E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 2.63E-19 4.69E-48 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 4.00E-14 1.14E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 4.54E-09 1.43E-39 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506874665 NA 1.05E-09 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251