\
| Variant ID: vg0506874665 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6874665 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 113. )
ATGGAAAGATCCATTTCGCCCGTATGGAAAAAGCTCTTCTGTACTAGTGAAATATTCAACTAGGTGCATGTCTCGCGGCGAAATACAATTGAAAGAGGAT[T/C]
TGGGGTAACGAAAAAGCTGTGGAAAATTCTTAATGGAATCCTGTATTACCGCAACCCAAACATTCAGACCAACATAACACATGCAGTTTGAGTAAATTCC
GGAATTTACTCAAACTGCATGTGTTATGTTGGTCTGAATGTTTGGGTTGCGGTAATACAGGATTCCATTAAGAATTTTCCACAGCTTTTTCGTTACCCCA[A/G]
ATCCTCTTTCAATTGTATTTCGCCGCGAGACATGCACCTAGTTGAATATTTCACTAGTACAGAAGAGCTTTTTCCATACGGGCGAAATGGATCTTTCCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.70% | 49.30% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 83.20% | 16.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 10.00% | 90.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.40% | 15.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 77.20% | 22.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 63.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506874665 | T -> C | LOC_Os05g12030.1 | upstream_gene_variant ; 3552.0bp to feature; MODIFIER | silent_mutation | Average:48.616; most accessible tissue: Zhenshan97 root, score: 69.506 | N | N | N | N |
| vg0506874665 | T -> C | LOC_Os05g12020.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.616; most accessible tissue: Zhenshan97 root, score: 69.506 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506874665 | 3.83E-13 | 2.35E-38 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 6.68E-10 | 2.41E-11 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | NA | 2.24E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | NA | 2.66E-06 | mr1344 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 9.64E-06 | 1.20E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | NA | 3.63E-07 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 2.64E-12 | 2.62E-35 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 1.79E-09 | 4.34E-12 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 6.77E-09 | NA | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 8.96E-06 | 2.57E-09 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 5.09E-18 | 2.74E-43 | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 1.70E-12 | 5.21E-12 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 7.56E-09 | 1.60E-21 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 4.36E-06 | 9.39E-07 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | NA | 8.79E-08 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 2.63E-19 | 4.69E-48 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 4.00E-14 | 1.14E-16 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | 4.54E-09 | 1.43E-39 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506874665 | NA | 1.05E-09 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |