\
| Variant ID: vg0506871977 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6871977 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 108. )
AATTAATAGCTAGATATTTTGCTTTATTTTTTCTTAGAATTTCTCTAATTTATTAGAGCGCCACTTGGCAGCCTAGGAGCGTTTGTAGAGATGTCATGTG[A/G]
CGGCTTAGGAGCATTTGTAGAAAGTTTTATAAACTTTTAGTATTATTTTTTTCTTAGAATTTTTCTAATTTATTAGAGCGCCACTTGACAGTCTAGGAGC
GCTCCTAGACTGTCAAGTGGCGCTCTAATAAATTAGAAAAATTCTAAGAAAAAAATAATACTAAAAGTTTATAAAACTTTCTACAAATGCTCCTAAGCCG[T/C]
CACATGACATCTCTACAAACGCTCCTAGGCTGCCAAGTGGCGCTCTAATAAATTAGAGAAATTCTAAGAAAAAATAAAGCAAAATATCTAGCTATTAATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.30% | 9.20% | 6.14% | 42.30% | NA |
| All Indica | 2759 | 11.90% | 12.80% | 6.74% | 68.54% | NA |
| All Japonica | 1512 | 95.30% | 0.50% | 2.84% | 1.32% | NA |
| Aus | 269 | 31.60% | 23.40% | 20.45% | 24.54% | NA |
| Indica I | 595 | 5.00% | 7.90% | 6.05% | 81.01% | NA |
| Indica II | 465 | 20.40% | 7.10% | 5.38% | 67.10% | NA |
| Indica III | 913 | 10.70% | 17.70% | 7.67% | 63.86% | NA |
| Indica Intermediate | 786 | 13.40% | 14.20% | 7.00% | 65.39% | NA |
| Temperate Japonica | 767 | 98.40% | 0.10% | 0.26% | 1.17% | NA |
| Tropical Japonica | 504 | 94.40% | 0.60% | 3.37% | 1.59% | NA |
| Japonica Intermediate | 241 | 87.10% | 1.70% | 9.96% | 1.24% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 57.80% | 12.20% | 6.67% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506871977 | A -> DEL | N | N | silent_mutation | Average:43.24; most accessible tissue: Callus, score: 60.287 | N | N | N | N |
| vg0506871977 | A -> G | LOC_Os05g12020.1 | upstream_gene_variant ; 1850.0bp to feature; MODIFIER | silent_mutation | Average:43.24; most accessible tissue: Callus, score: 60.287 | N | N | N | N |
| vg0506871977 | A -> G | LOC_Os05g12010.1 | downstream_gene_variant ; 3736.0bp to feature; MODIFIER | silent_mutation | Average:43.24; most accessible tissue: Callus, score: 60.287 | N | N | N | N |
| vg0506871977 | A -> G | LOC_Os05g12010-LOC_Os05g12020 | intergenic_region ; MODIFIER | silent_mutation | Average:43.24; most accessible tissue: Callus, score: 60.287 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506871977 | 9.67E-11 | 2.52E-40 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 3.36E-08 | 7.45E-10 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | NA | 3.60E-11 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | NA | 2.74E-08 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 1.31E-08 | 1.67E-41 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 5.10E-07 | 2.05E-12 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 2.80E-09 | 1.31E-48 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 8.35E-06 | 4.46E-10 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 5.76E-12 | 1.38E-42 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 2.21E-08 | 6.99E-10 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 4.43E-10 | 4.77E-20 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 5.75E-07 | 8.01E-08 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | NA | 1.65E-08 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 9.26E-15 | 4.43E-55 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 8.65E-11 | 4.03E-15 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 1.96E-07 | 7.72E-07 | mr1750_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 1.18E-08 | 1.86E-40 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506871977 | 2.91E-06 | 4.19E-08 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |