\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506870368:

Variant ID: vg0506870368 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6870368
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCCTTTATTTTCGGTGCCTGATGATATATATGCTCATTAGATATCAACTAACCATTAGGTGCATTGTGCATGGATACCTCGTGAGTAATATGACTTGG[C/T]
GATCAATAAATAGTGACTTGTATATAAAACCTACATATAGGGGGATCAATGAGGACATATGATTGATATTTTAGGCTAGGATTGTCCAAGTATATTGCAT

Reverse complement sequence

ATGCAATATACTTGGACAATCCTAGCCTAAAATATCAATCATATGTCCTCATTGATCCCCCTATATGTAGGTTTTATATACAAGTCACTATTTATTGATC[G/A]
CCAAGTCATATTACTCACGAGGTATCCATGCACAATGCACCTAATGGTTAGTTGATATCTAATGAGCATATATATCATCAGGCACCGAAAATAAAGGGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.90% 0.04% 0.00% NA
All Indica  2759 88.50% 11.40% 0.07% 0.00% NA
All Japonica  1512 4.70% 95.30% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 95.80% 4.00% 0.17% 0.00% NA
Indica II  465 80.20% 19.60% 0.22% 0.00% NA
Indica III  913 89.60% 10.40% 0.00% 0.00% NA
Indica Intermediate  786 86.80% 13.20% 0.00% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 12.90% 87.10% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506870368 C -> T LOC_Os05g12020.1 upstream_gene_variant ; 3459.0bp to feature; MODIFIER silent_mutation Average:32.62; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg0506870368 C -> T LOC_Os05g12010.1 downstream_gene_variant ; 2127.0bp to feature; MODIFIER silent_mutation Average:32.62; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg0506870368 C -> T LOC_Os05g12010-LOC_Os05g12020 intergenic_region ; MODIFIER silent_mutation Average:32.62; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506870368 1.08E-13 3.03E-42 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 3.23E-09 2.19E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 NA 4.69E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 NA 2.77E-11 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 NA 4.66E-09 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 2.25E-10 3.66E-43 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 9.95E-08 4.55E-13 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 5.11E-10 4.22E-50 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 NA 2.00E-10 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 NA 1.87E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 5.82E-17 1.11E-45 mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 8.08E-10 1.28E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 1.61E-08 1.77E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 8.57E-13 7.71E-22 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 4.41E-07 4.65E-08 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 9.31E-07 9.31E-07 mr1514_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 NA 4.74E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 3.62E-21 4.83E-60 mr1632_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 1.44E-12 2.39E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 5.87E-08 2.83E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 2.42E-10 6.31E-43 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 1.44E-06 1.43E-08 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870368 6.96E-06 NA mr1968_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251