Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506870338:

Variant ID: vg0506870338 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6870338
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATTTGTTGATCATTGCACACTTAGTATTTCCCTTTATTTTCGGTGCCTGATGATATATATGCTCATTAGATATCAACTAACCATTAGGTGCATTGTG[C/G]
ATGGATACCTCGTGAGTAATATGACTTGGCGATCAATAAATAGTGACTTGTATATAAAACCTACATATAGGGGGATCAATGAGGACATATGATTGATATT

Reverse complement sequence

AATATCAATCATATGTCCTCATTGATCCCCCTATATGTAGGTTTTATATACAAGTCACTATTTATTGATCGCCAAGTCATATTACTCACGAGGTATCCAT[G/C]
CACAATGCACCTAATGGTTAGTTGATATCTAATGAGCATATATATCATCAGGCACCGAAAATAAAGGGAAATACTAAGTGTGCAATGATCAACAAATGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 10.70% 0.00% 0.00% NA
All Indica  2759 82.10% 17.90% 0.00% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.80% 5.20% 0.00% 0.00% NA
Indica II  465 70.80% 29.20% 0.00% 0.00% NA
Indica III  913 74.50% 25.50% 0.00% 0.00% NA
Indica Intermediate  786 88.20% 11.80% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506870338 C -> G LOC_Os05g12020.1 upstream_gene_variant ; 3489.0bp to feature; MODIFIER silent_mutation Average:35.012; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N
vg0506870338 C -> G LOC_Os05g12010.1 downstream_gene_variant ; 2097.0bp to feature; MODIFIER silent_mutation Average:35.012; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N
vg0506870338 C -> G LOC_Os05g12010-LOC_Os05g12020 intergenic_region ; MODIFIER silent_mutation Average:35.012; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506870338 4.91E-70 7.98E-121 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870338 3.81E-53 4.88E-90 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870338 1.04E-23 1.27E-40 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870338 1.78E-20 7.32E-29 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870338 1.00E-90 4.65E-133 mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870338 2.63E-61 3.97E-94 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870338 5.01E-12 8.14E-19 mr1514_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870338 3.44E-09 1.17E-09 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870338 1.56E-48 1.63E-68 mr1632_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870338 4.25E-34 3.74E-48 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870338 3.40E-10 NA mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506870338 3.43E-08 4.88E-10 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251