\
| Variant ID: vg0506869876 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6869876 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGCGGCGGCATGGTGTGGCTTCTTTTACCATCCATCTCATTAAGAGTGGTCACTACGTATATGCTCAATTTAGAAAAACCTTAGAGCCTGGAAAGAAAGA[G/C]
AAAACTACCATATGGGGCATACCATATACACACTCTTCTTTTTTTCTTTTTATATTTCTTGCGTATGTATGTACATAGGAGTTGTGTATGTACATAAGGA
TCCTTATGTACATACACAACTCCTATGTACATACATACGCAAGAAATATAAAAAGAAAAAAAGAAGAGTGTGTATATGGTATGCCCCATATGGTAGTTTT[C/G]
TCTTTCTTTCCAGGCTCTAAGGTTTTTCTAAATTGAGCATATACGTAGTGACCACTCTTAATGAGATGGATGGTAAAAGAAGCCACACCATGCCGCCGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 10.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 82.10% | 17.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.50% | 25.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506869876 | G -> C | LOC_Os05g12020.1 | upstream_gene_variant ; 3951.0bp to feature; MODIFIER | silent_mutation | Average:39.455; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| vg0506869876 | G -> C | LOC_Os05g12010.1 | downstream_gene_variant ; 1635.0bp to feature; MODIFIER | silent_mutation | Average:39.455; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| vg0506869876 | G -> C | LOC_Os05g12010-LOC_Os05g12020 | intergenic_region ; MODIFIER | silent_mutation | Average:39.455; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506869876 | 1.30E-70 | 2.07E-123 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506869876 | 2.68E-54 | 2.03E-90 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506869876 | 1.99E-24 | 1.30E-41 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506869876 | 2.19E-20 | 1.04E-28 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506869876 | 5.18E-84 | 2.78E-132 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506869876 | 1.03E-59 | 1.19E-93 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506869876 | 6.36E-12 | 1.88E-19 | mr1514_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506869876 | 1.73E-10 | 5.85E-11 | mr1514_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506869876 | 2.91E-42 | 1.66E-66 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506869876 | 3.37E-32 | 2.62E-47 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506869876 | 1.80E-09 | NA | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506869876 | 4.68E-08 | 4.35E-10 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |