\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506869268:

Variant ID: vg0506869268 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6869268
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GTATGAGTGAGAGAAAATGGAGATGATGAAAATAGTTTTTTTTAATGTCTTGAGTCGATTTATTGTATAGAGTGTACATAATTTGTTTACGGTGTTAATC[G/A]
ATACTACTAAATTTTAGTGGTACATATATAATTTTAAAAATTAGCAGGGTTCATCATTGGACTCTACTTCGAAAAATCTAATAGCTTTAGTGGTGAGGAC

Reverse complement sequence

GTCCTCACCACTAAAGCTATTAGATTTTTCGAAGTAGAGTCCAATGATGAACCCTGCTAATTTTTAAAATTATATATGTACCACTAAAATTTAGTAGTAT[C/T]
GATTAACACCGTAAACAAATTATGTACACTCTATACAATAAATCGACTCAAGACATTAAAAAAAACTATTTTCATCATCTCCATTTTCTCTCACTCATAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 48.50% 0.11% 0.00% NA
All Indica  2759 83.10% 16.70% 0.18% 0.00% NA
All Japonica  1512 4.70% 95.30% 0.00% 0.00% NA
Aus  269 10.40% 89.60% 0.00% 0.00% NA
Indica I  595 91.90% 7.90% 0.17% 0.00% NA
Indica II  465 79.80% 20.00% 0.22% 0.00% NA
Indica III  913 84.40% 15.40% 0.11% 0.00% NA
Indica Intermediate  786 77.00% 22.80% 0.25% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 12.90% 87.10% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 37.80% 62.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506869268 G -> A LOC_Os05g12000.1 upstream_gene_variant ; 4753.0bp to feature; MODIFIER silent_mutation Average:36.676; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0506869268 G -> A LOC_Os05g12020.1 upstream_gene_variant ; 4559.0bp to feature; MODIFIER silent_mutation Average:36.676; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0506869268 G -> A LOC_Os05g12010.1 downstream_gene_variant ; 1027.0bp to feature; MODIFIER silent_mutation Average:36.676; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0506869268 G -> A LOC_Os05g12010-LOC_Os05g12020 intergenic_region ; MODIFIER silent_mutation Average:36.676; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506869268 3.22E-12 1.84E-37 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 2.33E-09 8.55E-11 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 NA 2.19E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 NA 9.84E-13 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 NA 1.50E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 8.33E-06 1.04E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 8.73E-11 9.66E-34 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 1.12E-07 1.97E-10 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 3.14E-07 NA mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 NA 5.56E-08 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 1.43E-15 3.94E-42 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 5.96E-11 3.71E-12 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 6.15E-10 5.55E-22 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 7.88E-07 3.25E-07 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 NA 3.46E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 NA 7.12E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 8.02E-18 2.50E-46 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 1.78E-14 6.14E-17 mr1632_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 9.58E-10 3.34E-40 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 1.37E-07 8.21E-12 mr1873_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506869268 NA 2.96E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251