\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506866456:

Variant ID: vg0506866456 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 6866456
Reference Allele: TAlternative Allele: C,TCC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAAAATGATCTTTCCAGACACCCGCTTTATTTTTGCAAACGGACCTAAAGAATATCTGCATATTAAATGATTTTAGAGGTGTAATAGGGAAGATTTGT[T/C,TCC]
TTGCAACAATTGCTTTTCACACGCGGACCCCTTAAGAGACTTGCATGTGAAAATAGAGTTATTTCCGTAGACGGGGCTCTTATGAGACCCGTATGTGAAA

Reverse complement sequence

TTTCACATACGGGTCTCATAAGAGCCCCGTCTACGGAAATAACTCTATTTTCACATGCAAGTCTCTTAAGGGGTCCGCGTGTGAAAAGCAATTGTTGCAA[A/G,GGA]
ACAAATCTTCCCTATTACACCTCTAAAATCATTTAATATGCAGATATTCTTTAGGTCCGTTTGCAAAAATAAAGCGGGTGTCTGGAAAGATCATTTTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 48.60% 0.02% 0.00% TCC: 0.02%
All Indica  2759 83.10% 16.80% 0.00% 0.00% TCC: 0.04%
All Japonica  1512 4.70% 95.30% 0.00% 0.00% NA
Aus  269 10.40% 89.60% 0.00% 0.00% NA
Indica I  595 91.90% 8.10% 0.00% 0.00% NA
Indica II  465 79.80% 20.20% 0.00% 0.00% NA
Indica III  913 84.30% 15.70% 0.00% 0.00% NA
Indica Intermediate  786 77.10% 22.80% 0.00% 0.00% TCC: 0.13%
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 5.80% 94.20% 0.00% 0.00% NA
Japonica Intermediate  241 12.40% 87.60% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 36.70% 62.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506866456 T -> TCC LOC_Os05g12000.1 upstream_gene_variant ; 1942.0bp to feature; MODIFIER silent_mutation Average:59.053; most accessible tissue: Callus, score: 82.253 N N N N
vg0506866456 T -> TCC LOC_Os05g12010.1 upstream_gene_variant ; 701.0bp to feature; MODIFIER silent_mutation Average:59.053; most accessible tissue: Callus, score: 82.253 N N N N
vg0506866456 T -> TCC LOC_Os05g11990.1 downstream_gene_variant ; 3822.0bp to feature; MODIFIER silent_mutation Average:59.053; most accessible tissue: Callus, score: 82.253 N N N N
vg0506866456 T -> TCC LOC_Os05g11990.2 downstream_gene_variant ; 3822.0bp to feature; MODIFIER silent_mutation Average:59.053; most accessible tissue: Callus, score: 82.253 N N N N
vg0506866456 T -> TCC LOC_Os05g12000-LOC_Os05g12010 intergenic_region ; MODIFIER silent_mutation Average:59.053; most accessible tissue: Callus, score: 82.253 N N N N
vg0506866456 T -> C LOC_Os05g12000.1 upstream_gene_variant ; 1941.0bp to feature; MODIFIER silent_mutation Average:59.053; most accessible tissue: Callus, score: 82.253 N N N N
vg0506866456 T -> C LOC_Os05g12010.1 upstream_gene_variant ; 702.0bp to feature; MODIFIER silent_mutation Average:59.053; most accessible tissue: Callus, score: 82.253 N N N N
vg0506866456 T -> C LOC_Os05g11990.1 downstream_gene_variant ; 3821.0bp to feature; MODIFIER silent_mutation Average:59.053; most accessible tissue: Callus, score: 82.253 N N N N
vg0506866456 T -> C LOC_Os05g11990.2 downstream_gene_variant ; 3821.0bp to feature; MODIFIER silent_mutation Average:59.053; most accessible tissue: Callus, score: 82.253 N N N N
vg0506866456 T -> C LOC_Os05g12000-LOC_Os05g12010 intergenic_region ; MODIFIER silent_mutation Average:59.053; most accessible tissue: Callus, score: 82.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506866456 1.78E-14 9.21E-38 mr1039 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 4.73E-11 1.15E-10 mr1039 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 NA 7.02E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 NA 4.73E-13 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 NA 1.37E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 NA 1.09E-09 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 NA 8.34E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 3.08E-11 1.46E-33 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 3.80E-08 3.42E-10 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 1.76E-08 NA mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 NA 5.19E-08 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 2.71E-16 3.24E-42 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 3.30E-11 8.77E-12 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 5.75E-09 6.92E-21 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 6.70E-06 3.77E-06 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 NA 1.82E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 1.17E-18 1.92E-46 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 2.14E-14 2.70E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 7.12E-10 7.07E-40 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506866456 2.16E-06 2.74E-10 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251