\
| Variant ID: vg0506861028 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6861028 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, T: 0.10, others allele: 0.00, population size: 295. )
AGGACTGCAATGAAGCCCTTAAGATTCAACCCAACTATTGGAAGGCTCTCCTAAGGCGTGCAGCTTCCTATGGCAAGGTAATACTTTGCTCAATCAAGAT[G/T]
CTTTTATGCACATGATGATTGATGCTGGAAGACTTATGTTGTGCACACTATTTGCTTCTTTGGTGATTAGATTGAACAATGGGCAGATTCCGTGAAAGAT
ATCTTTCACGGAATCTGCCCATTGTTCAATCTAATCACCAAAGAAGCAAATAGTGTGCACAACATAAGTCTTCCAGCATCAATCATCATGTGCATAAAAG[C/A]
ATCTTGATTGAGCAAAGTATTACCTTGCCATAGGAAGCTGCACGCCTTAGGAGAGCCTTCCAATAGTTGGGTTGAATCTTAAGGGCTTCATTGCAGTCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.30% | 46.40% | 0.28% | 0.02% | NA |
| All Indica | 2759 | 83.90% | 15.60% | 0.43% | 0.04% | NA |
| All Japonica | 1512 | 2.70% | 97.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 47.60% | 52.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.20% | 19.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 84.20% | 15.30% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 79.30% | 19.80% | 0.76% | 0.13% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 63.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506861028 | G -> T | LOC_Os05g12000.1 | downstream_gene_variant ; 2650.0bp to feature; MODIFIER | silent_mutation | Average:70.416; most accessible tissue: Callus, score: 81.032 | N | N | N | N |
| vg0506861028 | G -> T | LOC_Os05g11990.1 | intron_variant ; MODIFIER | silent_mutation | Average:70.416; most accessible tissue: Callus, score: 81.032 | N | N | N | N |
| vg0506861028 | G -> T | LOC_Os05g11990.2 | intron_variant ; MODIFIER | silent_mutation | Average:70.416; most accessible tissue: Callus, score: 81.032 | N | N | N | N |
| vg0506861028 | G -> DEL | N | N | silent_mutation | Average:70.416; most accessible tissue: Callus, score: 81.032 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506861028 | 6.74E-11 | 4.00E-38 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 2.28E-09 | 1.57E-10 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | NA | 5.91E-11 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 8.74E-06 | 3.87E-08 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 8.80E-08 | 1.55E-34 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 5.59E-08 | 1.82E-10 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 2.94E-07 | 4.90E-42 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 3.17E-06 | 1.97E-09 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 1.06E-13 | 2.27E-43 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 5.15E-10 | 1.49E-11 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 1.21E-06 | 8.74E-17 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | NA | 6.16E-06 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | NA | 2.95E-08 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 9.89E-17 | 3.10E-54 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 1.47E-13 | 4.31E-16 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | NA | 3.19E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 1.75E-10 | 4.13E-44 | mr1873_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506861028 | 1.37E-07 | 2.44E-11 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |