\
| Variant ID: vg0506849318 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6849318 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )
CCTTGTGTGATAGGAATATGAAACAGCTGGCCGATATAAGTAAATGCAATTACACATGGTTTTATAAAAGTAATGTGAAAACATGATTTTATACAGGTCC[G/A]
AGGACCATGGGCAGATCTTGCACAGCAGGGCTCTTCTCCGGTCATGCAACAAGACTCTTTAACCAATAATATAGAGAACAGATGGGTGCAGTAGATTTAG
CTAAATCTACTGCACCCATCTGTTCTCTATATTATTGGTTAAAGAGTCTTGTTGCATGACCGGAGAAGAGCCCTGCTGTGCAAGATCTGCCCATGGTCCT[C/T]
GGACCTGTATAAAATCATGTTTTCACATTACTTTTATAAAACCATGTGTAATTGCATTTACTTATATCGGCCAGCTGTTTCATATTCCTATCACACAAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.20% | 10.70% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 82.10% | 17.80% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.90% | 11.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506849318 | G -> A | LOC_Os05g11980.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.521; most accessible tissue: Callus, score: 70.096 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506849318 | 1.04E-72 | 2.50E-125 | mr1039 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849318 | 3.81E-56 | 6.66E-93 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849318 | 2.08E-25 | 1.25E-42 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849318 | 2.78E-21 | 8.98E-30 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849318 | 2.46E-90 | 3.27E-137 | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849318 | 2.54E-65 | 2.31E-99 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849318 | 7.27E-11 | 2.41E-18 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849318 | 1.53E-09 | 3.42E-10 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849318 | 1.27E-44 | 2.48E-68 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849318 | 1.82E-34 | 2.37E-49 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849318 | 1.29E-09 | NA | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849318 | 2.96E-08 | 3.29E-10 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |