\
| Variant ID: vg0506849316 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6849316 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 254. )
TTCCTTGTGTGATAGGAATATGAAACAGCTGGCCGATATAAGTAAATGCAATTACACATGGTTTTATAAAAGTAATGTGAAAACATGATTTTATACAGGT[C/T]
CGAGGACCATGGGCAGATCTTGCACAGCAGGGCTCTTCTCCGGTCATGCAACAAGACTCTTTAACCAATAATATAGAGAACAGATGGGTGCAGTAGATTT
AAATCTACTGCACCCATCTGTTCTCTATATTATTGGTTAAAGAGTCTTGTTGCATGACCGGAGAAGAGCCCTGCTGTGCAAGATCTGCCCATGGTCCTCG[G/A]
ACCTGTATAAAATCATGTTTTCACATTACTTTTATAAAACCATGTGTAATTGCATTTACTTATATCGGCCAGCTGTTTCATATTCCTATCACACAAGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.50% | 11.40% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 82.00% | 17.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.80% | 11.80% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506849316 | C -> T | LOC_Os05g11980.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.582; most accessible tissue: Callus, score: 70.096 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506849316 | 4.94E-62 | 9.14E-112 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849316 | 3.81E-56 | 6.66E-93 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849316 | 6.59E-23 | 8.05E-39 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849316 | 2.78E-21 | 8.98E-30 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849316 | 4.51E-78 | 8.70E-121 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849316 | 2.54E-65 | 2.31E-99 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849316 | 1.53E-11 | 5.70E-18 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849316 | 1.53E-09 | 3.42E-10 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849316 | 1.94E-40 | 2.32E-61 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849316 | 1.82E-34 | 2.37E-49 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849316 | 2.18E-09 | NA | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506849316 | 2.96E-08 | 3.29E-10 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |