\
| Variant ID: vg0506847525 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6847525 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 281. )
AACAGAATTGTTCGCAAGAGTAGATATTAGTCGGGATACATTGAAATCAACTTCACTAGTAGCAGGGGGTTGATCATCAAGTGAAGAGTCTGAAGTCCCA[T/C]
CCTCTTCATCAATTAGATTTCCTTTCAGTTCACCATTGTCTGCACGAGATGGCTCGCCTTCACAATGCGAGGTGCTATCCAGATTAACTGATGTGCCAGC
GCTGGCACATCAGTTAATCTGGATAGCACCTCGCATTGTGAAGGCGAGCCATCTCGTGCAGACAATGGTGAACTGAAAGGAAATCTAATTGATGAAGAGG[A/G]
TGGGACTTCAGACTCTTCACTTGATGATCAACCCCCTGCTACTAGTGAAGTTGATTTCAATGTATCCCGACTAATATCTACTCTTGCGAACAATTCTGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.50% | 11.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 82.00% | 17.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 70.50% | 29.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.00% | 11.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506847525 | T -> C | LOC_Os05g11980.1 | missense_variant ; p.Asp619Gly; MODERATE | nonsynonymous_codon ; D619G | Average:34.312; most accessible tissue: Callus, score: 63.871 | benign |
1.239 |
TOLERATED | 0.58 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506847525 | 3.65E-62 | 6.14E-112 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506847525 | 1.96E-56 | 4.24E-93 | mr1039 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506847525 | 6.66E-23 | 7.84E-39 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506847525 | 2.71E-21 | 9.79E-30 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506847525 | 2.96E-78 | 8.01E-121 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506847525 | 1.20E-65 | 3.26E-99 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506847525 | 1.57E-11 | 6.20E-18 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506847525 | 1.60E-09 | 3.95E-10 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506847525 | 1.30E-40 | 1.96E-61 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506847525 | 9.70E-35 | 2.18E-49 | mr1632_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506847525 | 2.11E-09 | NA | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506847525 | 2.74E-08 | 3.27E-10 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |