\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506847027:

Variant ID: vg0506847027 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6847027
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, A: 0.34, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


ATCACCAAGAGAATCTGCTATGTTTATTGAACCTCTCCATCCCTTACTTGAACCAATTTCGCCACCCTTGTTTGTAGCATCTTTTGTGATATCACTCAGA[A/C]
GAGCATCAGCATCAATGCAATGGCACTCCTTGCGTGTTTTCCAAAAGAGTACATCAACAAATAGCAATGGTTGTTTCTTCATTACCCTCAGCATCTTTCT

Reverse complement sequence

AGAAAGATGCTGAGGGTAATGAAGAAACAACCATTGCTATTTGTTGATGTACTCTTTTGGAAAACACGCAAGGAGTGCCATTGCATTGATGCTGATGCTC[T/G]
TCTGAGTGATATCACAAAAGATGCTACAAACAAGGGTGGCGAAATTGGTTCAAGTAAGGGATGGAGAGGTTCAATAAACATAGCAGATTCTCTTGGTGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 41.50% 0.02% 0.30% NA
All Indica  2759 88.70% 10.80% 0.00% 0.47% NA
All Japonica  1512 4.90% 95.10% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 80.20% 19.40% 0.00% 0.43% NA
Indica III  913 89.50% 10.10% 0.00% 0.44% NA
Indica Intermediate  786 87.20% 12.00% 0.00% 0.89% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 38.90% 58.90% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506847027 A -> DEL LOC_Os05g11980.1 N frameshift_variant Average:34.698; most accessible tissue: Callus, score: 62.028 N N N N
vg0506847027 A -> C LOC_Os05g11980.1 missense_variant ; p.Leu760Arg; MODERATE nonsynonymous_codon ; L760C Average:34.698; most accessible tissue: Callus, score: 62.028 benign 0.623 DELETERIOUS 0.02
vg0506847027 A -> C LOC_Os05g11980.1 missense_variant ; p.Leu760Arg; MODERATE nonsynonymous_codon ; L760R Average:34.698; most accessible tissue: Callus, score: 62.028 probably damaging 2.271 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506847027 8.40E-13 6.40E-43 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 1.33E-09 1.35E-11 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 5.01E-07 1.25E-12 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 5.08E-06 4.99E-07 mr1514 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 NA 1.24E-06 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 1.45E-14 3.45E-47 mr1632 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 3.12E-10 8.20E-16 mr1632 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 9.90E-12 1.36E-51 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 2.22E-06 1.30E-11 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 NA 3.91E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 NA 2.12E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 6.42E-16 1.81E-44 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 1.11E-11 3.47E-11 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 1.59E-10 8.77E-21 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 2.09E-07 2.00E-08 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 NA 1.20E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 1.93E-17 6.56E-57 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 2.87E-13 3.53E-17 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 7.18E-08 3.62E-40 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506847027 NA 8.20E-08 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251