\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506844240:

Variant ID: vg0506844240 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6844240
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TTCACAGCAGTCTATTCTGGTGAATAAGTTTCACACAGCCTAGAGCCCGTAAAATAACATCTGAATCATTCCTGTTTTTTTTATGAAGCTTATGATATGA[C/T]
ACTGATAACACTACAGAAGTAGTTCACACATTTGCTAACAAGTATGAAGAGAACAGATCAGACAGTTTGAAGAATTTTTGTGCCAAGATGAACGAACTTA

Reverse complement sequence

TAAGTTCGTTCATCTTGGCACAAAAATTCTTCAAACTGTCTGATCTGTTCTCTTCATACTTGTTAGCAAATGTGTGAACTACTTCTGTAGTGTTATCAGT[G/A]
TCATATCATAAGCTTCATAAAAAAAACAGGAATGATTCAGATGTTATTTTACGGGCTCTAGGCTGTGTGAAACTTATTCACCAGAATAGACTGCTGTGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 41.60% 0.36% 0.49% NA
All Indica  2759 87.60% 11.00% 0.54% 0.83% NA
All Japonica  1512 4.80% 95.20% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 93.80% 4.00% 0.84% 1.34% NA
Indica II  465 79.60% 19.60% 0.43% 0.43% NA
Indica III  913 88.50% 10.40% 0.22% 0.88% NA
Indica Intermediate  786 86.80% 11.80% 0.76% 0.64% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 41.10% 56.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506844240 C -> T LOC_Os05g11970.1 downstream_gene_variant ; 1490.0bp to feature; MODIFIER silent_mutation Average:41.774; most accessible tissue: Callus, score: 56.055 N N N N
vg0506844240 C -> T LOC_Os05g11980.1 intron_variant ; MODIFIER silent_mutation Average:41.774; most accessible tissue: Callus, score: 56.055 N N N N
vg0506844240 C -> DEL N N silent_mutation Average:41.774; most accessible tissue: Callus, score: 56.055 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506844240 1.05E-08 6.76E-36 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 7.00E-07 7.74E-08 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 NA 3.26E-10 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 NA 6.60E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 2.21E-06 2.89E-37 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 NA 3.17E-09 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 9.14E-07 7.17E-44 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 NA 1.97E-08 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 NA 1.41E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 5.64E-08 7.95E-37 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 NA 2.06E-07 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 4.38E-07 9.42E-17 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 NA 1.43E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 2.43E-10 4.12E-48 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 3.33E-07 3.19E-11 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 2.76E-06 3.90E-06 mr1865_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 6.70E-07 2.07E-37 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506844240 NA 7.25E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251