\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506840667:

Variant ID: vg0506840667 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6840667
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAATATATAATACTTCCCTCGAAATAATTTCAAAATTTTCGGTCAGGAATTTTAAACCATGGTCAGCCGTACCACCTGAAACTTGAATTGGGTCGTT[A/G]
GATTGCACCACAGGTAATCTGATTAGCTGAGCTCGGAAAACAAATCCTAATAGGCTCAAATTTTGATGAATTGTAATTTGATTTATCTTTTATAGATCGA

Reverse complement sequence

TCGATCTATAAAAGATAAATCAAATTACAATTCATCAAAATTTGAGCCTATTAGGATTTGTTTTCCGAGCTCAGCTAATCAGATTACCTGTGGTGCAATC[T/C]
AACGACCCAATTCAAGTTTCAGGTGGTACGGCTGACCATGGTTTAAAATTCCTGACCGAAAATTTTGAAATTATTTCGAGGGAAGTATTATATATTTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.00% 40.20% 4.68% 13.16% NA
All Indica  2759 11.60% 58.90% 7.79% 21.71% NA
All Japonica  1512 95.20% 4.20% 0.07% 0.53% NA
Aus  269 29.00% 68.40% 0.37% 2.23% NA
Indica I  595 4.20% 64.20% 18.66% 12.94% NA
Indica II  465 20.40% 41.70% 5.81% 32.04% NA
Indica III  913 10.70% 63.20% 1.75% 24.32% NA
Indica Intermediate  786 12.80% 60.20% 7.76% 19.21% NA
Temperate Japonica  767 98.30% 0.90% 0.00% 0.78% NA
Tropical Japonica  504 94.40% 5.00% 0.20% 0.40% NA
Japonica Intermediate  241 86.70% 13.30% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 58.90% 27.80% 4.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506840667 A -> DEL N N silent_mutation Average:47.829; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0506840667 A -> G LOC_Os05g11960.1 upstream_gene_variant ; 4301.0bp to feature; MODIFIER silent_mutation Average:47.829; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0506840667 A -> G LOC_Os05g11980.1 downstream_gene_variant ; 2798.0bp to feature; MODIFIER silent_mutation Average:47.829; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0506840667 A -> G LOC_Os05g11970.1 intron_variant ; MODIFIER silent_mutation Average:47.829; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506840667 2.74E-13 6.05E-44 mr1039 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 1.31E-08 3.49E-12 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 3.00E-06 1.96E-12 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 1.86E-10 8.42E-44 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 2.09E-07 1.84E-13 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 1.41E-10 2.73E-50 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 5.39E-06 3.89E-11 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 NA 6.09E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 3.01E-09 3.62E-43 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 NA 6.78E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 3.82E-10 6.24E-20 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 3.85E-06 3.08E-07 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 NA 3.07E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 2.12E-15 5.05E-57 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 1.35E-09 3.20E-15 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 9.20E-09 9.15E-40 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506840667 8.85E-06 2.67E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251