\
| Variant ID: vg0506837520 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6837520 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )
TTTGAAAATAAAATAAATTGTGAAAACTCGCGATACAGGGGTTGTGCCTGTGTGGCGTTGTCCCGTATTTGCATATAAGGACCAATTCATGTGGGAAATT[C/T]
ATCCGAGCATATAACAAGTGCGACCACACGGGTAGAATGAGACGCTCTTGGTTGAGTAAATAGCAAACCAGGGAAGCCTTGATGCCAAGAGACAAGTGGA
TCCACTTGTCTCTTGGCATCAAGGCTTCCCTGGTTTGCTATTTACTCAACCAAGAGCGTCTCATTCTACCCGTGTGGTCGCACTTGTTATATGCTCGGAT[G/A]
AATTTCCCACATGAATTGGTCCTTATATGCAAATACGGGACAACGCCACACAGGCACAACCCCTGTATCGCGAGTTTTCACAATTTATTTTATTTTCAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.00% | 11.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 81.70% | 18.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.30% | 25.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.20% | 12.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506837520 | C -> T | LOC_Os05g11960.1 | upstream_gene_variant ; 1154.0bp to feature; MODIFIER | silent_mutation | Average:46.078; most accessible tissue: Callus, score: 61.805 | N | N | N | N |
| vg0506837520 | C -> T | LOC_Os05g11970.1 | upstream_gene_variant ; 1273.0bp to feature; MODIFIER | silent_mutation | Average:46.078; most accessible tissue: Callus, score: 61.805 | N | N | N | N |
| vg0506837520 | C -> T | LOC_Os05g11960-LOC_Os05g11970 | intergenic_region ; MODIFIER | silent_mutation | Average:46.078; most accessible tissue: Callus, score: 61.805 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506837520 | 1.13E-68 | 2.91E-120 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506837520 | 2.81E-52 | 2.26E-86 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506837520 | 1.12E-24 | 3.83E-41 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506837520 | 1.22E-20 | 5.93E-28 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506837520 | NA | 9.54E-06 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506837520 | 8.18E-82 | 1.57E-129 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506837520 | 1.49E-58 | 4.77E-90 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506837520 | 9.98E-12 | 2.08E-19 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506837520 | 2.48E-10 | 8.59E-11 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506837520 | 3.02E-44 | 4.12E-67 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506837520 | 2.66E-34 | 2.02E-47 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506837520 | 8.19E-11 | NA | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506837520 | 1.72E-09 | 9.13E-12 | mr1873_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |