\
| Variant ID: vg0506835795 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6835795 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 104. )
GCCACCGCGCCATTGCCACCTCAGCGTCAAGTTTGCCGCCGGGTGCCGCCGCTCGACAAACGCACTCCGTCTCCTTGTCCTCCGTCGACCGAACAACGGT[C/T]
GTCGCCGCCTCATCGCGACCCTGTCCGTGCCGCCCCGGTGCCGTGATCATGACCCACGCCCCCGTGCGCCACCGACTCCCACTCACCACCGGATCACCGC
GCGGTGATCCGGTGGTGAGTGGGAGTCGGTGGCGCACGGGGGCGTGGGTCATGATCACGGCACCGGGGCGGCACGGACAGGGTCGCGATGAGGCGGCGAC[G/A]
ACCGTTGTTCGGTCGACGGAGGACAAGGAGACGGAGTGCGTTTGTCGAGCGGCGGCACCCGGCGGCAAACTTGACGCTGAGGTGGCAATGGCGCGGTGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 41.70% | 0.19% | 0.08% | NA |
| All Indica | 2759 | 88.60% | 11.00% | 0.29% | 0.11% | NA |
| All Japonica | 1512 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 70.60% | 29.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 4.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 80.00% | 19.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 89.40% | 10.30% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 87.30% | 12.20% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 57.80% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506835795 | C -> T | LOC_Os05g11960.1 | synonymous_variant ; p.Thr172Thr; LOW | synonymous_codon | Average:68.936; most accessible tissue: Callus, score: 81.775 | N | N | N | N |
| vg0506835795 | C -> DEL | LOC_Os05g11960.1 | N | frameshift_variant | Average:68.936; most accessible tissue: Callus, score: 81.775 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506835795 | 5.43E-11 | 1.41E-42 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | 9.30E-08 | 8.84E-11 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | NA | 2.41E-11 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | NA | 1.32E-08 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | 5.15E-09 | 1.24E-42 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | 3.60E-06 | 2.67E-12 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | 4.02E-09 | 1.82E-48 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | NA | 1.63E-09 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | NA | 4.68E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | 3.07E-10 | 1.73E-43 | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | 3.50E-06 | 7.88E-10 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | 5.08E-09 | 1.09E-19 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | NA | 1.61E-06 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | NA | 1.56E-08 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | 3.60E-14 | 2.22E-56 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | 5.59E-09 | 1.09E-14 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | 4.41E-06 | 1.05E-37 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835795 | NA | 2.00E-06 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |