\
| Variant ID: vg0506835785 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6835785 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 104. )
GCTCCCCACCGCCACCGCGCCATTGCCACCTCAGCGTCAAGTTTGCCGCCGGGTGCCGCCGCTCGACAAACGCACTCCGTCTCCTTGTCCTCCGTCGACC[G/A]
AACAACGGTCGTCGCCGCCTCATCGCGACCCTGTCCGTGCCGCCCCGGTGCCGTGATCATGACCCACGCCCCCGTGCGCCACCGACTCCCACTCACCACC
GGTGGTGAGTGGGAGTCGGTGGCGCACGGGGGCGTGGGTCATGATCACGGCACCGGGGCGGCACGGACAGGGTCGCGATGAGGCGGCGACGACCGTTGTT[C/T]
GGTCGACGGAGGACAAGGAGACGGAGTGCGTTTGTCGAGCGGCGGCACCCGGCGGCAAACTTGACGCTGAGGTGGCAATGGCGCGGTGGCGGTGGGGAGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 41.70% | 0.23% | 0.02% | NA |
| All Indica | 2759 | 88.70% | 11.00% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 70.60% | 29.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.00% | 19.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 89.50% | 10.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 87.30% | 12.20% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 61.10% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506835785 | G -> DEL | LOC_Os05g11960.1 | N | frameshift_variant | Average:70.153; most accessible tissue: Callus, score: 81.775 | N | N | N | N |
| vg0506835785 | G -> A | LOC_Os05g11960.1 | missense_variant ; p.Arg176Trp; MODERATE | nonsynonymous_codon ; R176W | Average:70.153; most accessible tissue: Callus, score: 81.775 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506835785 | 4.27E-10 | 1.32E-41 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | 3.65E-07 | 3.14E-11 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | NA | 4.65E-11 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | NA | 9.98E-08 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | 2.16E-07 | 1.93E-40 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | NA | 1.59E-12 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | 2.58E-08 | 6.78E-47 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | NA | 1.33E-09 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | NA | 4.78E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | 3.49E-06 | 4.38E-40 | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | NA | 8.52E-09 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | 1.48E-08 | 4.12E-19 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | NA | 1.82E-06 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | NA | 5.18E-09 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | 1.18E-11 | 1.32E-53 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | 1.95E-07 | 5.24E-14 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | NA | 7.12E-36 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506835785 | NA | 3.10E-06 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |