Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506835240:

Variant ID: vg0506835240 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6835240
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

CCGCTCGGGAGAGCTCCCTCCCTCCCTCTCTCTCTTTGTTCTCTCTCCCTCTCTTTGATCTTCCGGCTGCCGCGATTCGATTTTCGCCGCCGCCCGTGGT[A/G]
TCCCGCGCGCTCCCCTGCCGTGGCCGACCGGAAGGACATCGGTGTCACTCCCTCTGGTCATCGCCTGCGCCGACGACCGTCCTGTCCCCGCTCCACTCCA

Reverse complement sequence

TGGAGTGGAGCGGGGACAGGACGGTCGTCGGCGCAGGCGATGACCAGAGGGAGTGACACCGATGTCCTTCCGGTCGGCCACGGCAGGGGAGCGCGCGGGA[T/C]
ACCACGGGCGGCGGCGAAAATCGAATCGCGGCAGCCGGAAGATCAAAGAGAGGGAGAGAGAACAAAGAGAGAGAGGGAGGGAGGGAGCTCTCCCGAGCGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.10%	6.50%	2.56%	1.90%	NA
All Indica	2759	81.80%	10.70%	4.31%	3.23%	NA
All Japonica	1512	99.50%	0.30%	0.13%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.60%	4.90%	0.50%	0.00%	NA
Indica II	465	70.50%	12.70%	11.61%	5.16%	NA
Indica III	913	74.30%	15.90%	3.83%	6.02%	NA
Indica Intermediate	786	87.40%	7.90%	3.44%	1.27%	NA
Temperate Japonica	767	99.60%	0.10%	0.13%	0.13%	NA
Tropical Japonica	504	99.00%	0.80%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506835240	A -> DEL	N	N	silent_mutation	Average:77.881; most accessible tissue: Callus, score: 96.17	N	N	N	N
vg0506835240	A -> G	LOC_Os05g11970.1	upstream_gene_variant ; 3553.0bp to feature; MODIFIER	silent_mutation	Average:77.881; most accessible tissue: Callus, score: 96.17	N	N	N	N
vg0506835240	A -> G	LOC_Os05g11960.1	intron_variant ; MODIFIER	silent_mutation	Average:77.881; most accessible tissue: Callus, score: 96.17	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506835240	1.05E-66	5.52E-122	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	1.28E-49	4.54E-84	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	2.02E-25	1.71E-43	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	6.76E-20	3.76E-27	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	7.83E-06	NA	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	NA	7.07E-06	mr1873	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	2.17E-79	2.00E-131	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	2.98E-55	6.59E-86	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	1.42E-11	4.22E-19	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	5.65E-10	3.00E-10	mr1514_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	4.79E-45	2.12E-68	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	5.33E-34	2.28E-46	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	1.53E-11	NA	mr1873_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835240	2.01E-09	1.42E-11	mr1873_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251