\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506835228:

Variant ID: vg0506835228 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6835228
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGCACGTGAGCCGCTCGGGAGAGCTCCCTCCCTCCCTCTCTCTCTTTGTTCTCTCTCCCTCTCTTTGATCTTCCGGCTGCCGCGATTCGATTTTCGCC[G/A]
CCGCCCGTGGTATCCCGCGCGCTCCCCTGCCGTGGCCGACCGGAAGGACATCGGTGTCACTCCCTCTGGTCATCGCCTGCGCCGACGACCGTCCTGTCCC

Reverse complement sequence

GGGACAGGACGGTCGTCGGCGCAGGCGATGACCAGAGGGAGTGACACCGATGTCCTTCCGGTCGGCCACGGCAGGGGAGCGCGCGGGATACCACGGGCGG[C/T]
GGCGAAAATCGAATCGCGGCAGCCGGAAGATCAAAGAGAGGGAGAGAGAACAAAGAGAGAGAGGGAGGGAGGGAGCTCTCCCGAGCGGCTCACGTGCGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 41.90% 1.57% 3.09% NA
All Indica  2759 80.90% 11.30% 2.61% 5.22% NA
All Japonica  1512 4.60% 95.20% 0.07% 0.13% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 95.00% 4.00% 0.67% 0.34% NA
Indica II  465 63.20% 20.00% 8.39% 8.39% NA
Indica III  913 79.00% 10.40% 1.53% 9.09% NA
Indica Intermediate  786 83.00% 12.60% 1.91% 2.54% NA
Temperate Japonica  767 1.30% 98.30% 0.13% 0.26% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 36.70% 62.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506835228 G -> DEL N N silent_mutation Average:77.136; most accessible tissue: Callus, score: 96.17 N N N N
vg0506835228 G -> A LOC_Os05g11970.1 upstream_gene_variant ; 3565.0bp to feature; MODIFIER silent_mutation Average:77.136; most accessible tissue: Callus, score: 96.17 N N N N
vg0506835228 G -> A LOC_Os05g11960.1 intron_variant ; MODIFIER silent_mutation Average:77.136; most accessible tissue: Callus, score: 96.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506835228 1.23E-12 1.98E-42 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 4.63E-09 5.68E-11 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 1.88E-06 2.48E-12 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 NA 9.38E-06 mr1514 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 NA 4.75E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 7.85E-11 5.24E-44 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 5.36E-08 9.41E-14 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 2.88E-10 2.60E-50 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 6.22E-06 1.58E-10 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 NA 1.17E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 1.11E-13 1.06E-44 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 7.12E-09 8.84E-11 mr1039_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 2.39E-10 4.65E-20 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 2.56E-06 2.61E-07 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 NA 3.12E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 8.64E-18 1.99E-58 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 4.89E-12 2.21E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 5.82E-09 1.67E-41 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506835228 6.97E-06 4.93E-08 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251