\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506828905:

Variant ID: vg0506828905 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6828905
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATACGCCATAGACTACTTTAAGTAGCATTTTAATTTTATTATATATTACTGAAATATATTGTCTATTAAAAATATAGCTAGTGATACTACTTCATCTAAT[T/C]
AAAGATGACTTATATTACTTATATTCCCTCTGTCACATAAATCGAAGGAGTTGAATTTTATCCCAAAACAATAGAAAAATTTATATGTAACCGGGACAAA

Reverse complement sequence

TTTGTCCCGGTTACATATAAATTTTTCTATTGTTTTGGGATAAAATTCAACTCCTTCGATTTATGTGACAGAGGGAATATAAGTAATATAAGTCATCTTT[A/G]
ATTAGATGAAGTAGTATCACTAGCTATATTTTTAATAGACAATATATTTCAGTAATATATAATAAAATTAAAATGCTACTTAAAGTAGTCTATGGCGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 41.90% 0.32% 0.00% NA
All Indica  2759 88.20% 11.30% 0.51% 0.00% NA
All Japonica  1512 4.80% 95.20% 0.00% 0.00% NA
Aus  269 70.30% 29.70% 0.00% 0.00% NA
Indica I  595 94.10% 4.20% 1.68% 0.00% NA
Indica II  465 80.00% 19.60% 0.43% 0.00% NA
Indica III  913 89.00% 10.80% 0.11% 0.00% NA
Indica Intermediate  786 87.50% 12.30% 0.13% 0.00% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 5.40% 94.60% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 41.10% 57.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506828905 T -> C LOC_Os05g11950.1 downstream_gene_variant ; 1543.0bp to feature; MODIFIER silent_mutation Average:39.425; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0506828905 T -> C LOC_Os05g11960.1 downstream_gene_variant ; 4218.0bp to feature; MODIFIER silent_mutation Average:39.425; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0506828905 T -> C LOC_Os05g11950.2 downstream_gene_variant ; 1543.0bp to feature; MODIFIER silent_mutation Average:39.425; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0506828905 T -> C LOC_Os05g11950-LOC_Os05g11960 intergenic_region ; MODIFIER silent_mutation Average:39.425; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506828905 5.73E-10 7.79E-40 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 6.79E-07 2.21E-09 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 1.16E-06 1.76E-12 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 NA 9.33E-06 mr1514 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 NA 2.47E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 1.15E-09 3.05E-42 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 3.64E-07 1.36E-12 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 4.16E-09 1.06E-49 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 NA 1.97E-09 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 NA 6.65E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 3.56E-10 5.80E-42 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 3.25E-06 1.69E-09 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 7.48E-09 4.95E-19 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 3.89E-06 2.50E-07 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 NA 1.11E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 5.67E-13 1.66E-54 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 8.44E-09 2.55E-14 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 1.83E-07 6.40E-40 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 NA 1.22E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828905 1.32E-06 1.32E-06 mr1877_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251