\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506828690:

Variant ID: vg0506828690 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6828690
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGGATGATATTTTTGAAATATTTTTTGACTCTATTTTAAACGTATGCTCGTTAATAACTGGTTTCGGCGTATTACTTGAAATTGTATATCTTCAAATT[T/A]
ATTAGAAAAAAATATGTCACCATAACGAAGTTAGTTCATATCTATTTGTATTATGTGTGATTCTTTTTTAAAAATTTTTGGAGTTTCCAAACTTTATATA

Reverse complement sequence

TATATAAAGTTTGGAAACTCCAAAAATTTTTAAAAAAGAATCACACATAATACAAATAGATATGAACTAACTTCGTTATGGTGACATATTTTTTTCTAAT[A/T]
AATTTGAAGATATACAATTTCAAGTAATACGCCGAAACCAGTTATTAACGAGCATACGTTTAAAATAGAGTCAAAAAATATTTCAAAAATATCATCCACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 25.90% 23.55% 8.27% NA
All Indica  2759 37.90% 10.40% 37.91% 13.81% NA
All Japonica  1512 48.70% 48.90% 2.18% 0.20% NA
Aus  269 63.20% 28.30% 8.55% 0.00% NA
Indica I  595 18.20% 3.50% 54.62% 23.70% NA
Indica II  465 38.90% 18.30% 29.89% 12.90% NA
Indica III  913 49.70% 9.50% 31.65% 9.09% NA
Indica Intermediate  786 38.50% 11.80% 37.28% 12.34% NA
Temperate Japonica  767 78.90% 16.90% 4.04% 0.13% NA
Tropical Japonica  504 11.90% 87.70% 0.20% 0.20% NA
Japonica Intermediate  241 29.50% 69.70% 0.41% 0.41% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 42.20% 37.80% 12.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506828690 T -> DEL N N silent_mutation Average:36.564; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0506828690 T -> A LOC_Os05g11950.1 downstream_gene_variant ; 1328.0bp to feature; MODIFIER silent_mutation Average:36.564; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0506828690 T -> A LOC_Os05g11960.1 downstream_gene_variant ; 4433.0bp to feature; MODIFIER silent_mutation Average:36.564; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0506828690 T -> A LOC_Os05g11950.2 downstream_gene_variant ; 1328.0bp to feature; MODIFIER silent_mutation Average:36.564; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0506828690 T -> A LOC_Os05g11950-LOC_Os05g11960 intergenic_region ; MODIFIER silent_mutation Average:36.564; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506828690 NA 1.69E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506828690 NA 2.11E-09 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 NA 2.57E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 NA 5.66E-06 mr1514 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 1.76E-08 1.53E-19 mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 NA 5.43E-09 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 3.57E-08 1.87E-20 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 5.99E-06 NA mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 3.89E-06 5.86E-12 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 NA 2.86E-09 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 1.73E-06 1.25E-09 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 NA 1.36E-07 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 4.86E-06 NA mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 1.91E-06 2.45E-07 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 NA 1.95E-23 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 NA 4.05E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 3.56E-07 1.16E-25 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 5.11E-08 NA mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 4.28E-09 3.63E-14 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506828690 NA 8.33E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251