\
| Variant ID: vg0506828690 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6828690 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.03, others allele: 0.00, population size: 117. )
TGTGGATGATATTTTTGAAATATTTTTTGACTCTATTTTAAACGTATGCTCGTTAATAACTGGTTTCGGCGTATTACTTGAAATTGTATATCTTCAAATT[T/A]
ATTAGAAAAAAATATGTCACCATAACGAAGTTAGTTCATATCTATTTGTATTATGTGTGATTCTTTTTTAAAAATTTTTGGAGTTTCCAAACTTTATATA
TATATAAAGTTTGGAAACTCCAAAAATTTTTAAAAAAGAATCACACATAATACAAATAGATATGAACTAACTTCGTTATGGTGACATATTTTTTTCTAAT[A/T]
AATTTGAAGATATACAATTTCAAGTAATACGCCGAAACCAGTTATTAACGAGCATACGTTTAAAATAGAGTCAAAAAATATTTCAAAAATATCATCCACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.30% | 25.90% | 23.55% | 8.27% | NA |
| All Indica | 2759 | 37.90% | 10.40% | 37.91% | 13.81% | NA |
| All Japonica | 1512 | 48.70% | 48.90% | 2.18% | 0.20% | NA |
| Aus | 269 | 63.20% | 28.30% | 8.55% | 0.00% | NA |
| Indica I | 595 | 18.20% | 3.50% | 54.62% | 23.70% | NA |
| Indica II | 465 | 38.90% | 18.30% | 29.89% | 12.90% | NA |
| Indica III | 913 | 49.70% | 9.50% | 31.65% | 9.09% | NA |
| Indica Intermediate | 786 | 38.50% | 11.80% | 37.28% | 12.34% | NA |
| Temperate Japonica | 767 | 78.90% | 16.90% | 4.04% | 0.13% | NA |
| Tropical Japonica | 504 | 11.90% | 87.70% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 29.50% | 69.70% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 37.80% | 12.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506828690 | T -> DEL | N | N | silent_mutation | Average:36.564; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0506828690 | T -> A | LOC_Os05g11950.1 | downstream_gene_variant ; 1328.0bp to feature; MODIFIER | silent_mutation | Average:36.564; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0506828690 | T -> A | LOC_Os05g11960.1 | downstream_gene_variant ; 4433.0bp to feature; MODIFIER | silent_mutation | Average:36.564; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0506828690 | T -> A | LOC_Os05g11950.2 | downstream_gene_variant ; 1328.0bp to feature; MODIFIER | silent_mutation | Average:36.564; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0506828690 | T -> A | LOC_Os05g11950-LOC_Os05g11960 | intergenic_region ; MODIFIER | silent_mutation | Average:36.564; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506828690 | NA | 1.69E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0506828690 | NA | 2.11E-09 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | NA | 2.57E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | NA | 5.66E-06 | mr1514 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | 1.76E-08 | 1.53E-19 | mr1593 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | NA | 5.43E-09 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | 3.57E-08 | 1.87E-20 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | 5.99E-06 | NA | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | 3.89E-06 | 5.86E-12 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | NA | 2.86E-09 | mr1873 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | 1.73E-06 | 1.25E-09 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | NA | 1.36E-07 | mr1195_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | 4.86E-06 | NA | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | 1.91E-06 | 2.45E-07 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | NA | 1.95E-23 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | NA | 4.05E-08 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | 3.56E-07 | 1.16E-25 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | 5.11E-08 | NA | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | 4.28E-09 | 3.63E-14 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506828690 | NA | 8.33E-07 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |