Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506827010:

Variant ID: vg0506827010 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6827010
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCAGCGTTGTCCGCGACGACATGGTCTATTAGATTACAGGTGATGATGACCTCCATGTTTTTTTTTCAATTTTTGGATCACCAGAGATGAAGAAGAAG[G/T]
ATATGGCGTATGGACTTGCCTTGAGTCGAGTTGGGTTGGACTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

Reverse complement sequence

TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAGTCCAACCCAACTCGACTCAAGGCAAGTCCATACGCCATAT[C/A]
CTTCTTCTTCATCTCTGGTGATCCAAAAATTGAAAAAAAAACATGGAGGTCATCATCACCTGTAATCTAATAGACCATGTCGTCGCGGACAACGCTGGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.60% 30.30% 12.91% 2.16% NA
All Indica  2759 27.50% 47.90% 21.57% 3.01% NA
All Japonica  1512 97.90% 0.60% 0.26% 1.19% NA
Aus  269 68.80% 29.00% 2.23% 0.00% NA
Indica I  595 7.60% 53.30% 37.48% 1.68% NA
Indica II  465 36.30% 46.20% 14.84% 2.58% NA
Indica III  913 35.90% 42.90% 17.20% 3.94% NA
Indica Intermediate  786 27.60% 50.60% 18.58% 3.18% NA
Temperate Japonica  767 99.00% 0.80% 0.26% 0.00% NA
Tropical Japonica  504 97.00% 0.60% 0.20% 2.18% NA
Japonica Intermediate  241 96.70% 0.00% 0.41% 2.90% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 65.60% 27.80% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506827010 G -> T LOC_Os05g11950.1 3_prime_UTR_variant ; 67.0bp to feature; MODIFIER silent_mutation Average:84.854; most accessible tissue: Zhenshan97 flower, score: 96.344 N N N N
vg0506827010 G -> T LOC_Os05g11950.2 3_prime_UTR_variant ; 67.0bp to feature; MODIFIER silent_mutation Average:84.854; most accessible tissue: Zhenshan97 flower, score: 96.344 N N N N
vg0506827010 G -> DEL N N silent_mutation Average:84.854; most accessible tissue: Zhenshan97 flower, score: 96.344 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0506827010 G T -0.1 -0.05 -0.04 -0.05 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506827010 1.64E-06 NA mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506827010 8.14E-08 5.96E-12 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506827010 NA 5.01E-12 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506827010 NA 2.33E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506827010 NA 6.28E-14 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506827010 8.38E-06 NA mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506827010 1.62E-06 1.07E-11 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506827010 NA 7.03E-22 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506827010 8.61E-07 NA mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506827010 1.05E-06 2.95E-14 mr1593_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506827010 NA 8.58E-07 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251