\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506761860:

Variant ID: vg0506761860 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6761860
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


GATTAATAATCATGGAATCAACAAAATTACTTCCATATATAATTATTGTGGTGTTACATGAATTTTATATGGTGATATTGTCGAGGGAAGATCCTCAATA[G/A]
CGGGGAATCGTGAGACCCCCCATTTGTGAGTTCGGCCGGGGGCGGAGGCTCGTCTCTCGGAAATCACTTGCTCGTCCCTAAGATTACCGGCAAGCTTGCA

Reverse complement sequence

TGCAAGCTTGCCGGTAATCTTAGGGACGAGCAAGTGATTTCCGAGAGACGAGCCTCCGCCCCCGGCCGAACTCACAAATGGGGGGTCTCACGATTCCCCG[C/T]
TATTGAGGATCTTCCCTCGACAATATCACCATATAAAATTCATGTAACACCACAATAATTATATATGGAAGTAATTTTGTTGATTCCATGATTATTAATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 48.30% 0.13% 0.00% NA
All Indica  2759 83.00% 16.80% 0.14% 0.00% NA
All Japonica  1512 3.40% 96.50% 0.13% 0.00% NA
Aus  269 23.80% 76.20% 0.00% 0.00% NA
Indica I  595 95.60% 4.40% 0.00% 0.00% NA
Indica II  465 74.20% 25.80% 0.00% 0.00% NA
Indica III  913 84.00% 16.00% 0.00% 0.00% NA
Indica Intermediate  786 77.60% 21.90% 0.51% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 3.00% 96.80% 0.20% 0.00% NA
Japonica Intermediate  241 10.00% 89.60% 0.41% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 33.30% 66.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506761860 G -> A LOC_Os05g11860.1 upstream_gene_variant ; 359.0bp to feature; MODIFIER silent_mutation Average:57.564; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0506761860 G -> A LOC_Os05g11870.1 upstream_gene_variant ; 4634.0bp to feature; MODIFIER silent_mutation Average:57.564; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0506761860 G -> A LOC_Os05g11860-LOC_Os05g11870 intergenic_region ; MODIFIER silent_mutation Average:57.564; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506761860 NA 1.51E-26 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860 NA 5.99E-13 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860 NA 3.14E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860 NA 3.11E-27 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860 NA 9.56E-06 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860 7.61E-06 NA mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860 NA 1.05E-30 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860 3.01E-06 NA mr1067_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860 5.83E-08 1.07E-19 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860 4.35E-08 2.66E-38 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860 NA 8.33E-09 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251