Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506761860:

Variant ID: vg0506761860 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6761860
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

GATTAATAATCATGGAATCAACAAAATTACTTCCATATATAATTATTGTGGTGTTACATGAATTTTATATGGTGATATTGTCGAGGGAAGATCCTCAATA[G/A]
CGGGGAATCGTGAGACCCCCCATTTGTGAGTTCGGCCGGGGGCGGAGGCTCGTCTCTCGGAAATCACTTGCTCGTCCCTAAGATTACCGGCAAGCTTGCA

Reverse complement sequence

TGCAAGCTTGCCGGTAATCTTAGGGACGAGCAAGTGATTTCCGAGAGACGAGCCTCCGCCCCCGGCCGAACTCACAAATGGGGGGTCTCACGATTCCCCG[C/T]
TATTGAGGATCTTCCCTCGACAATATCACCATATAAAATTCATGTAACACCACAATAATTATATATGGAAGTAATTTTGTTGATTCCATGATTATTAATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.50%	48.30%	0.13%	0.00%	NA
All Indica	2759	83.00%	16.80%	0.14%	0.00%	NA
All Japonica	1512	3.40%	96.50%	0.13%	0.00%	NA
Aus	269	23.80%	76.20%	0.00%	0.00%	NA
Indica I	595	95.60%	4.40%	0.00%	0.00%	NA
Indica II	465	74.20%	25.80%	0.00%	0.00%	NA
Indica III	913	84.00%	16.00%	0.00%	0.00%	NA
Indica Intermediate	786	77.60%	21.90%	0.51%	0.00%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	3.00%	96.80%	0.20%	0.00%	NA
Japonica Intermediate	241	10.00%	89.60%	0.41%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	33.30%	66.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506761860	G -> A	LOC_Os05g11860.1	upstream_gene_variant ; 359.0bp to feature; MODIFIER	silent_mutation	Average:57.564; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0506761860	G -> A	LOC_Os05g11870.1	upstream_gene_variant ; 4634.0bp to feature; MODIFIER	silent_mutation	Average:57.564; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0506761860	G -> A	LOC_Os05g11860-LOC_Os05g11870	intergenic_region ; MODIFIER	silent_mutation	Average:57.564; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506761860	NA	1.51E-26	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860	NA	5.99E-13	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860	NA	3.14E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860	NA	3.11E-27	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860	NA	9.56E-06	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860	7.61E-06	NA	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860	NA	1.05E-30	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860	3.01E-06	NA	mr1067_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860	5.83E-08	1.07E-19	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860	4.35E-08	2.66E-38	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506761860	NA	8.33E-09	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251