\
| Variant ID: vg0506761860 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6761860 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 116. )
GATTAATAATCATGGAATCAACAAAATTACTTCCATATATAATTATTGTGGTGTTACATGAATTTTATATGGTGATATTGTCGAGGGAAGATCCTCAATA[G/A]
CGGGGAATCGTGAGACCCCCCATTTGTGAGTTCGGCCGGGGGCGGAGGCTCGTCTCTCGGAAATCACTTGCTCGTCCCTAAGATTACCGGCAAGCTTGCA
TGCAAGCTTGCCGGTAATCTTAGGGACGAGCAAGTGATTTCCGAGAGACGAGCCTCCGCCCCCGGCCGAACTCACAAATGGGGGGTCTCACGATTCCCCG[C/T]
TATTGAGGATCTTCCCTCGACAATATCACCATATAAAATTCATGTAACACCACAATAATTATATATGGAAGTAATTTTGTTGATTCCATGATTATTAATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 48.30% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 83.00% | 16.80% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 3.40% | 96.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 23.80% | 76.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.20% | 25.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.00% | 16.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 77.60% | 21.90% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 3.00% | 96.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.00% | 89.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 66.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506761860 | G -> A | LOC_Os05g11860.1 | upstream_gene_variant ; 359.0bp to feature; MODIFIER | silent_mutation | Average:57.564; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0506761860 | G -> A | LOC_Os05g11870.1 | upstream_gene_variant ; 4634.0bp to feature; MODIFIER | silent_mutation | Average:57.564; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0506761860 | G -> A | LOC_Os05g11860-LOC_Os05g11870 | intergenic_region ; MODIFIER | silent_mutation | Average:57.564; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506761860 | NA | 1.51E-26 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506761860 | NA | 5.99E-13 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506761860 | NA | 3.14E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506761860 | NA | 3.11E-27 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506761860 | NA | 9.56E-06 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506761860 | 7.61E-06 | NA | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506761860 | NA | 1.05E-30 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506761860 | 3.01E-06 | NA | mr1067_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506761860 | 5.83E-08 | 1.07E-19 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506761860 | 4.35E-08 | 2.66E-38 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506761860 | NA | 8.33E-09 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |